Clone Read LE_HBa0037A05_T7_80265

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0037A05_T7_80265
Primer
T7
ID from Seq. Facility
LE_HBa_037_A05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
718 trimmed for vector and quality, 853 raw
Genbank Accession
Sequence
>LE_HBa0037A05_T7_80265 (raw untrimmed)
GGGGGTATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTGTCGGTCACGTTCCTTGGAGCTGCGGCCACCCAAATCGACTCGCTTTCTCGTCGAAGG
ATCACCGGAGAAAAACATACTTGAAAAATCACAATAATTCTTATGATTGATAAATCTAGATTTTGTTGAATTGATCTTAAAATAGTAGCAGCAACAAAAG
GAGGACTCGGGAATGGGTGTATATTTTACTTTAGGTTCTTTTCGTTCAACTCAAGAGAATTTCTTATATAATTATATATATAAGCCAAAACGGATTTAGA
ATAACCTTTGGCATTTAATTTTTTTTTTTCGTTCAATGCTCGAAGTTCATATTATCTAAGGTTTCGAATTAAGATTTTTAATTAACAAAAAAAAAATTTA
TTATCATGCATCACAATCCATATTAATTAAAAAGGAAAAATTTGAGTTTATTGCTTTATTCGTCTAATTATTTATGTTAATATTATTAGATGTTGTATTT
TAATTAATTAAATGACATTTTTTTTAAAAAAAAAGTTAAAAAAGGAAAAGTTGAAAGAAAACATCATGAAAAAAGAATCTTTTAACCTTTAAAGATCCGA
AAATGAAAAGATTGGCCTCATATGTCTTACAAATTCGACATTCAACCAATATGGTAAAGTCTAAACCTTAAAAGGGTCGTTTTTGTTTGAATATGAACTA
TGAGGGGATAAATTCTGTTAATATTAAATTATGAAAGATAAAATTATGTTGAGATTTTTTTCCCTTCGGCGTTGATTTTGCTAACTCAAAATAATAACCA
TTAACTAAAAATTTAAAAACCGAGGCTTGTTGCCTTCCACATTTATTCTTCTT
>LE_HBa0037A05_T7_80265 (trimmed for quality and cloning vector)
AGCTTCTGTCGGTCACGTTCCTTGGAGCTGCGGCCACCCAAATCGACTCGCTTTCTCGTCGAAGGATCACCGGAGAAAAACATACTTGAAAAATCACAAT
AATTCTTATGATTGATAAATCTAGATTTTGTTGAATTGATCTTAAAATAGTAGCAGCAACAAAAGGAGGACTCGGGAATGGGTGTATATTTTACTTTAGG
TTCTTTTCGTTCAACTCAAGAGAATTTCTTATATAATTATATATATAAGCCAAAACGGATTTAGAATAACCTTTGGCATTTAATTTTTTTTTTTCGTTCA
ATGCTCGAAGTTCATATTATCTAAGGTTTCGAATTAAGATTTTTAATTAACAAAAAAAAAATTTATTATCATGCATCACAATCCATATTAATTAAAAAGG
AAAAATTTGAGTTTATTGCTTTATTCGTCTAATTATTTATGTTAATATTATTAGATGTTGTATTTTAATTAATTAAATGACATTTTTTTTAAAAAAAAAG
TTAAAAAAGGAAAAGTTGAAAGAAAACATCATGAAAAAAGAATCTTTTAACCTTTAAAGATCCGAAAATGAAAAGATTGGCCTCATATGTCTTACAAATT
CGACATTCAACCAATATGGTAAAGTCTAAACCTTAAAAGGGTCGTTTTTGTTTGAATATGAACTATGAGGGGATAAATTCTGTTAATATTAAATTATGAA
AGATAAAATTATGTTGAG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.904218
Expected error %
1.05111
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0037A05
Clone
Clone name
hba-37a5
LE_HBa0037A05
P037A05
Clone type
BAC
Contamination
none
Estimated length
133,734
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found