Clone Read LE_HBa0034P08_T7_8031

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0034P08_T7_8031
Primer
T7
ID from Seq. Facility
LE_HBa_034_P08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
804 trimmed for vector and quality, 852 raw
Genbank Accession
Sequence
>LE_HBa0034P08_T7_8031 (raw untrimmed)
ACTGGGTCCCGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTAAGTATTTCATCATATAAAGGTAAAGAATTGATAAAAAGAACAAAAGTA
TAAGACAGTAGAGAAGAAAAGCAACATGATTACAAAGACTATAGAGAAATACGAACTGTGAAATGACAGTGGATATGGCAGCTCCGGACACACCCAAGCC
GAAATAGTACATAAGTAAGGGAAACAAAAATATAGCTGCAAAGTTCCCAATGCCTGCACAAATAATATGCTACATCATTACAAAGATACAACTTAGCTCC
ATTAATATATCTAGGAACGATACAGAATTGCATTTGTAATTACAGCAAATTGCATTTACAAAAAAGCTTTAGATTTTATCCCCTCCGATTTTACTTTTTC
ATCACAATATTATTATTTTAGGGATCAAACATAGTTTACATGACAGTAAGTTTACGAGTACATTAAGAATAAAAACATTTTTTTATGTAGTATATAAATA
GTATTCTCTAAGAATTTAGATCCAAAACTGGGGATTATAAAAGGAAATATTTCCATTTCCACCTTCATACGTATACATACTGAACATACTCAAGTGCAAA
TAAGCAATTAAGAATACAGTGATTAGAGGAGAAGATATATATCTTAGATGACAAAGGTGTTCCGGGTTAATTAGAACGTTATTGAAGGGAAAATTGTCTG
CCACAAATTTAGGATACCCAAAAGTTGGAATTTCTATGTCAAAACCGCATAAATGAAACCAGCAGAAAGGATATTGGGCAAGAACTATTATCACTTAAAT
AGCCAACGATCCAAGACTTGCCTAAACAGAAGACTGGAGTCTTTGTATCCTT
>LE_HBa0034P08_T7_8031 (trimmed for quality and cloning vector)
AGCTTGTAAGTATTTCATCATATAAAGGTAAAGAATTGATAAAAAGAACAAAAGTATAAGACAGTAGAGAAGAAAAGCAACATGATTACAAAGACTATAG
AGAAATACGAACTGTGAAATGACAGTGGATATGGCAGCTCCGGACACACCCAAGCCGAAATAGTACATAAGTAAGGGAAACAAAAATATAGCTGCAAAGT
TCCCAATGCCTGCACAAATAATATGCTACATCATTACAAAGATACAACTTAGCTCCATTAATATATCTAGGAACGATACAGAATTGCATTTGTAATTACA
GCAAATTGCATTTACAAAAAAGCTTTAGATTTTATCCCCTCCGATTTTACTTTTTCATCACAATATTATTATTTTAGGGATCAAACATAGTTTACATGAC
AGTAAGTTTACGAGTACATTAAGAATAAAAACATTTTTTTATGTAGTATATAAATAGTATTCTCTAAGAATTTAGATCCAAAACTGGGGATTATAAAAGG
AAATATTTCCATTTCCACCTTCATACGTATACATACTGAACATACTCAAGTGCAAATAAGCAATTAAGAATACAGTGATTAGAGGAGAAGATATATATCT
TAGATGACAAAGGTGTTCCGGGTTAATTAGAACGTTATTGAAGGGAAAATTGTCTGCCACAAATTTAGGATACCCAAAAGTTGGAATTTCTATGTCAAAA
CCGCATAAATGAAACCAGCAGAAAGGATATTGGGCAAGAACTATTATCACTTAAATAGCCAACGATCCAAGACTTGCCTAAACAGAAGACTGGAGTCTTT
GTAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.932656
Expected error %
0.207735
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0034P08
Clone
Clone name
hba-34p8
LE_HBa0034P08
P034P08
Clone type
BAC
Contamination
none
Estimated length
93,943
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found