Clone Read LE_HBa0037H06_T7_80603

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0037H06_T7_80603
Primer
T7
ID from Seq. Facility
LE_HBa_037_H06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
768 trimmed for vector and quality, 816 raw
Genbank Accession
Sequence
>LE_HBa0037H06_T7_80603 (raw untrimmed)
AACCCCGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGTCAAAGGAGAAGAGATATACAATAATCCTTCAACAAATCTCTTATAA
TGGACGTCCATGCCCAAGAAACTCGTTATATCTTTTGGAGATGTGGGTCTAGTCCAACTCTGAACCTCTTCAATCTATTTTGTGTACACTTTAATCGCTT
GAACAGAAATAATACCGCATATGAATCCCATAGACATAATCCAAAACTCAAACATGGACACTTGATATATATCTAGCTTCTTATCTCTTAATGTCTAGAG
AATAATCATGTGATGACTATCATGATCTTCTTCATTCCTTGAATAAACCAGTATGTTATCAATGAAGACGATAACAAAAAACTCTAAATAATGTTTGAAG
ACTATGTTCATAAGATCCATGAACGCTTCATGTGTATTTGTCAAACCAAAGGACATAATAAAAATTCATGATGCCCATATATTGTTCTGAAATTGTTTTT
GGAATATCACATTCCCTTACATTCAAATGATGATAGCCTTAGTGGAGGTTAATTTGGGAAAAGGAAGAAGCTCCCTGAAGTTGATCAAAATGATAATCTA
TCCTTGAAGAGGATATTTATTCTTAATGATAACCTTATTTAATTGGTGGTAGTCTATACACATCATATGAAACTATCTTTCTTCTTTACAAACAAGACCG
GAGAGCCCCAAGGTGAGACACTTCGTCCTAATTAAGCCTTTATTTTAACATATCCTTTCAATTTCTATATTAACTCTTTTAAACTCGGCTTGTTTCCTTT
CGGTATTGGCCTGAAT
>LE_HBa0037H06_T7_80603 (trimmed for quality and cloning vector)
AGCTTGGTCAAAGGAGAAGAGATATACAATAATCCTTCAACAAATCTCTTATAATGGACGTCCATGCCCAAGAAACTCGTTATATCTTTTGGAGATGTGG
GTCTAGTCCAACTCTGAACCTCTTCAATCTATTTTGTGTACACTTTAATCGCTTGAACAGAAATAATACCGCATATGAATCCCATAGACATAATCCAAAA
CTCAAACATGGACACTTGATATATATCTAGCTTCTTATCTCTTAATGTCTAGAGAATAATCATGTGATGACTATCATGATCTTCTTCATTCCTTGAATAA
ACCAGTATGTTATCAATGAAGACGATAACAAAAAACTCTAAATAATGTTTGAAGACTATGTTCATAAGATCCATGAACGCTTCATGTGTATTTGTCAAAC
CAAAGGACATAATAAAAATTCATGATGCCCATATATTGTTCTGAAATTGTTTTTGGAATATCACATTCCCTTACATTCAAATGATGATAGCCTTAGTGGA
GGTTAATTTGGGAAAAGGAAGAAGCTCCCTGAAGTTGATCAAAATGATAATCTATCCTTGAAGAGGATATTTATTCTTAATGATAACCTTATTTAATTGG
TGGTAGTCTATACACATCATATGAAACTATCTTTCTTCTTTACAAACAAGACCGGAGAGCCCCAAGGTGAGACACTTCGTCCTAATTAAGCCTTTATTTT
AACATATCCTTTCAATTTCTATATTAACTCTTTTAAACTCGGCTTGTTTCCTTTCGGTATTGGCCTGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.944269
Expected error %
0.918666
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38744.1| Score 179 E Value 9e-44 Identity 15.60% Align. Length 692bp (90.10%) Frame 1
putative gag-pol polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38724.1| Score 177 E Value 3e-43 Identity 15.40% Align. Length 692bp (90.10%) Frame 1
putative retrotransposon protein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0037H06
Clone
Clone name
hba-37h6
LE_HBa0037H06
C10HBa0037H06
P037H06
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found