Clone Read LE_HBa0037K05_SP6_80744

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0037K05_SP6_80744
Primer
SP6
ID from Seq. Facility
LE_HBa_037_K05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
602 trimmed for vector and quality, 847 raw
Genbank Accession
Sequence
>LE_HBa0037K05_SP6_80744 (raw untrimmed)
TTTAAAAAACTGTCTCCGAAACACCCCCAACAATTATTCGCAGGGTGGTATTGAAGAAATCATTTCAGATCTATTAACAAAAAAAGGCATTGAAAAGACA
TGACCATGTTGTTTGTACTCCAGTCATAATTCATTGATTGTATGGTCAACACATCCATGTTTGGCGAATTTTCAAGAACCACATTAATGGTTATTCAGTG
ACAATTCACGAAATAGTAGTTTGGACCTAATAGCTTAAATCTAATATGTAATGTCACCAAAACTTAGACTACTGACCATTCCCTTTAAGAGCTTTCTGCT
CGTACGTAGAGAGCTCAATCCAGGTTCTTTTGGTCTTTTAGCTCCCTGAAATTGCAAGTCAGTTATTCACTTCTCAATTATATCCAGAGAATAAATGAAA
AACTGCAGGAAACTTAACAAAGGAAGAAATATAGAGAAAAATTATTAAACCTTCAAGTAACCCCCAGGATCATGAGTATCAATTCCAAGAAGGTGCCCCA
ATCCATGAGGCATGAAAACAGCACCAAGTCGCTCGGCCATCATTTTATCAACATCCCTTTGATCAAAGTAAAGAAATCCCTATTCCATATCAGCTATTCC
AGACTCTATAGGAAAGGCTCGTGAGAGAGAGTAATTAAAGAAGGGAGTAGAAGATACCCAACAAGTAGGTTCCCTTTCTTCAGTGATTCCAAAATGACCC
CTTTCGCTTATCTGCAATTCTTGGTGAAATACCTTGTGAAAAACAGCTACAATGATTTGTGTAAAGGCAGAAATTCATGGCCTGTGAAAACTGAACCGTT
AAACCCTTTTTCCCCTGAATTTAGCACATAATAAACACTTATAGAAT
>LE_HBa0037K05_SP6_80744 (trimmed for quality and cloning vector)
GGTATTGAAGAAATCATTTCAGATCTATTAACAAAAAAAGGCATTGAAAAGACATGACCATGTTGTTTGTACTCCAGTCATAATTCATTGATTGTATGGT
CAACACATCCATGTTTGGCGAATTTTCAAGAACCACATTAATGGTTATTCAGTGACAATTCACGAAATAGTAGTTTGGACCTAATAGCTTAAATCTAATA
TGTAATGTCACCAAAACTTAGACTACTGACCATTCCCTTTAAGAGCTTTCTGCTCGTACGTAGAGAGCTCAATCCAGGTTCTTTTGGTCTTTTAGCTCCC
TGAAATTGCAAGTCAGTTATTCACTTCTCAATTATATCCAGAGAATAAATGAAAAACTGCAGGAAACTTAACAAAGGAAGAAATATAGAGAAAAATTATT
AAACCTTCAAGTAACCCCCAGGATCATGAGTATCAATTCCAAGAAGGTGCCCCAATCCATGAGGCATGAAAACAGCACCAAGTCGCTCGGCCATCATTTT
ATCAACATCCCTTTGATCAAAGTAAAGAAATCCCTATTCCATATCAGCTATTCCAGACTCTATAGGAAAGGCTCGTGAGAGAGAGTAATTAAAGAAGGGA
GT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.963389
Expected error %
0.0344776
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g29500.1 Score 65 E Value 3e-11 Identity 12.70% Align. Length 299bp (49.67%) Frame 1
68417.m04209 prolidase-related contains similarity to prolidase GI:3114966 from [Suberites domuncula]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_464731.1| Score 69 E Value 6e-11 Identity 13.70% Align. Length 299bp (49.67%) Frame 1
putative Xaa-Pro dipeptidase [Oryza sativa (japonica cultivar-group)] dbj|BAD17065.1| putative Xaa-Pro dipeptidase [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0037K05
Clone
Clone name
hba-37k5
LE_HBa0037K05
P037K05
Clone type
BAC
Contamination
none
Estimated length
149,512
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found