Clone Read LE_HBa0037K05_T7_80745

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0037K05_T7_80745
Primer
T7
ID from Seq. Facility
LE_HBa_037_K05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
758 trimmed for vector and quality, 874 raw
Genbank Accession
Sequence
>LE_HBa0037K05_T7_80745 (raw untrimmed)
TCGGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATAATCTAATTTGAAAAACCATTGAATGAGAATCGATCAGTGGCGGTGGCAA
TTACCATTTTTTCCAGCAAACAAGGGTTAGTTTACTTTTTTTCCTTTTTTTTTGGGTCCTATTGAATTTAGCTAGAACACTTCTTAGTACTTGGTTTTAT
AGAATTAATCTTTTACAACTAATTAAATTTCACATATAACAAATTTAGTGATTGGGGAAAAGCATAACAATAACATATTATTTTTAAATCATAATTTCAT
CCTTGGACACCACGTGCCCCAAGAATATCACGAACTCAAACTAAAGCTAACACTTAGAGAACTTAATATATATTTGATGTTACACAAAGTCTAAAGCACA
ACCTTAAACAATTGCCCATGTTCATCCTACTCCTCAAATAGATTAGGATATCATCAATGAATATTATCACAAGGGAGTTTAAATAGTGCCTGAATAAATG
ACTCGTTGAATTCATAAATGTTGTTGCAGAATTAATCAAACCATAAGACATAATTAGAAACTCATAATGATTGTAAAAAGTCTCAAAAGTGTCTTTGGTT
TGTGTGTCACAATAATCTTTAACTTATGGTAGCTTGATCTCACATCTATCTTAGAGAACATTGTTGCACCCTGAAGCAAGTCAAATAAATCATTAATTGT
ACCACATCGAATACCTTTTATTGATGATCATTGTCCCAACTCGAGCCTATACCCTGGGACGTGGTCAGTATTTAAAAAAAATTGTTGGGCTCCAAGAAAA
ATCCTCATCATGGTTGAATACAAACCAAAGACCTCCTTCAGAATACCCCTTTTTCAAAACTGAAAAGTTTTTTT
>LE_HBa0037K05_T7_80745 (trimmed for quality and cloning vector)
AGCTTATAATCTAATTTGAAAAACCATTGAATGAGAATCGATCAGTGGCGGTGGCAATTACCATTTTTTCCAGCAAACAAGGGTTAGTTTACTTTTTTTC
CTTTTTTTTTGGGTCCTATTGAATTTAGCTAGAACACTTCTTAGTACTTGGTTTTATAGAATTAATCTTTTACAACTAATTAAATTTCACATATAACAAA
TTTAGTGATTGGGGAAAAGCATAACAATAACATATTATTTTTAAATCATAATTTCATCCTTGGACACCACGTGCCCCAAGAATATCACGAACTCAAACTA
AAGCTAACACTTAGAGAACTTAATATATATTTGATGTTACACAAAGTCTAAAGCACAACCTTAAACAATTGCCCATGTTCATCCTACTCCTCAAATAGAT
TAGGATATCATCAATGAATATTATCACAAGGGAGTTTAAATAGTGCCTGAATAAATGACTCGTTGAATTCATAAATGTTGTTGCAGAATTAATCAAACCA
TAAGACATAATTAGAAACTCATAATGATTGTAAAAAGTCTCAAAAGTGTCTTTGGTTTGTGTGTCACAATAATCTTTAACTTATGGTAGCTTGATCTCAC
ATCTATCTTAGAGAACATTGTTGCACCCTGAAGCAAGTCAAATAAATCATTAATTGTACCACATCGAATACCTTTTATTGATGATCATTGTCCCAACTCG
AGCCTATACCCTGGGACGTGGTCAGTATTTAAAAAAAATTGTTGGGCTCCAAGAAAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.945997
Expected error %
0.720539
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38744.1| Score 72 E Value 2e-24 Identity 45.50% Align. Length 410bp (54.09%) Frame 2
putative gag-pol polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38724.1| Score 72 E Value 2e-24 Identity 45.50% Align. Length 410bp (54.09%) Frame 2
putative retrotransposon protein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0037K05
Clone
Clone name
hba-37k5
LE_HBa0037K05
P037K05
Clone type
BAC
Contamination
none
Estimated length
149,512
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found