Clone Read LE_HBa0052B21_T7_81113

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0052B21_T7_81113
Primer
T7
ID from Seq. Facility
LE_HBa_052_B21-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
579 trimmed for vector and quality, 862 raw
Sequence
>LE_HBa0052B21_T7_81113 (raw untrimmed)
AAAAAACTCGGTCCCGGGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATGATGTTGCTTTAGTTTCCCCATACTTATGTTTTTTCCTTTCAGT
TGGATACTAAACATTTTATTACCTATATGTGGTCTGATTTCATTGATGTATGTTCTAAGCCCATATTAATACACTCTTGTTAGATGGTTATTACATGTGA
CATGATTTTGAGACTATCTTATATTTTATATATATAACTATGTGTAATAAAATTATAAGACTAAGCAATCTTCCTATAAGAAGGGTCTATGTATTCTCAA
TCTATATCTATGATGAGTATGTAGATGTTTATGTAAACCTTAATGTAGAAGTAATGAAAAGTTTTAATTTTTCCATGTTTTTGATCTATGAATGTAGTGA
TGTAAGCTAATAAGCTTGTATTAATTTTCAAAAGATGTGCAATTTTAAAAATCTTCAATAAACCTCCTAAAAAGGACAACATTCCCTATAAACTTCTCAC
AAATTTGACAAGATGGGCGGGGAAGGTTTTTTATAACCTCAACTTTGGTCTGGTCAACCTCTATTCCGTTTTCTAACAATCAACGGACAAAAACTATGCC
TTCCTTCACCGTAAAGTGACATTTTTCCCAATTTAGCATCAAATTGCAATCTTCAAATCTATTGAGAAACTCAATCAAGTTTTTCAAGCACCCCATGAAA
GGATTCCTCAAAAACTATAAAAATATCCTTGAACACCTCATTATTGTCCTCTATCATAAAGGGAATATGAACCTTCCCACAACAATAGAAGGAAGCCAAT
GAGTATCATAACCCAAATGACATCCTTTTAAAGGAAAAGTCCCAATAAGGATATGTGATGTG
>LE_HBa0052B21_T7_81113 (trimmed for quality and cloning vector)
AGCTTATGATGTTGCTTTAGTTTCCCCATACTTATGTTTTTTCCTTTCAGTTGGATACTAAACATTTTATTACCTATATGTGGTCTGATTTCATTGATGT
ATGTTCTAAGCCCATATTAATACACTCTTGTTAGATGGTTATTACATGTGACATGATTTTGAGACTATCTTATATTTTATATATATAACTATGTGTAATA
AAATTATAAGACTAAGCAATCTTCCTATAAGAAGGGTCTATGTATTCTCAATCTATATCTATGATGAGTATGTAGATGTTTATGTAAACCTTAATGTAGA
AGTAATGAAAAGTTTTAATTTTTCCATGTTTTTGATCTATGAATGTAGTGATGTAAGCTAATAAGCTTGTATTAATTTTCAAAAGATGTGCAATTTTAAA
AATCTTCAATAAACCTCCTAAAAAGGACAACATTCCCTATAAACTTCTCACAAATTTGACAAGATGGGCGGGGAAGGTTTTTTATAACCTCAACTTTGGT
CTGGTCAACCTCTATTCCGTTTTCTAACAATCAACGGACAAAAACTATGCCTTCCTTCACCGTAAAGTGACATTTTTCC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.930973
Expected error %
0.975621
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0052B21
Clone
Clone name
hba-52b21
LE_HBa0052B21
P052B21
Clone type
BAC
Contamination
none
Estimated length
162,745
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found