Clone Read LE_HBa0052F03_T7_81269

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0052F03_T7_81269
Primer
T7
ID from Seq. Facility
LE_HBa_052_F03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
789 trimmed for vector and quality, 898 raw
Sequence
>LE_HBa0052F03_T7_81269 (raw untrimmed)
CCTCACCTGGGTACCGGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTATGAAACTAGGAGTTGACCCTTTTTGTTACAACTATAGAGTTTTA
ACTTCTGCACACTACTCATCATTCACTTACCCCTTAAATCGGACAACGATGCATGAGATATCATCTTTACTTTCTCTAGTTAACGCTTCTATGGCTAATT
GCTTGGATGCCTTCTGTGGGTCCTTAACCTTCTTCGCGATGTCAACTGCCTCTTGATTAGACATTACCTGAAATATCACCAATTATCAATTAGAGAATGA
AAGGAGTGCAATAAGGGAAAGACAGCAACTGAATATTGGAGCAAAGGGCACCTTCCATAGGCCATCACTTGCAAGGATGAGAAGATCTGTATCTCCATCA
ACATCAATGGTTGTTACATCAGGATCAGAGCGCAAGTGTGATTTCAGGTTCTTGTCTCCAAAAGCGCGAGATACAGCTAGTTGACCATTCACTCTAGCAA
CATCTCCTGAGATAATAGGCATTTTAACACAGATGTAGAAACATATTCCAAAATACAGTAATATTACGTAAAGTGCCACGTCTAGATCACATCTGCATAG
TTTGGCACACTGAGGACAGCAGCGTAAATTCTAAATCTACATAAGAACAGGTCTGTTTGGTGCAAGAAGACCCTCGAATTCTTGCAAGGAAAAAGATTCT
TCTATGTAACTTTTTCCCATCCAATTTATTTTTTTCTCTAAATAAATGAAAGTTGATTCCAGGGTGAGGTACGAATAACCAACAACAGATCTAACACAGA
CACCCTATACATAGATGTCGGACCGCCAATCACAAAACCCTAAAAATGTCTGGATATTGGTAATCAAGAGGTCAAAAAAATTTTATGACCAGCACTCT
>LE_HBa0052F03_T7_81269 (trimmed for quality and cloning vector)
AGCTTCTATGAAACTAGGAGTTGACCCTTTTTGTTACAACTATAGAGTTTTAACTTCTGCACACTACTCATCATTCACTTACCCCTTAAATCGGACAACG
ATGCATGAGATATCATCTTTACTTTCTCTAGTTAACGCTTCTATGGCTAATTGCTTGGATGCCTTCTGTGGGTCCTTAACCTTCTTCGCGATGTCAACTG
CCTCTTGATTAGACATTACCTGAAATATCACCAATTATCAATTAGAGAATGAAAGGAGTGCAATAAGGGAAAGACAGCAACTGAATATTGGAGCAAAGGG
CACCTTCCATAGGCCATCACTTGCAAGGATGAGAAGATCTGTATCTCCATCAACATCAATGGTTGTTACATCAGGATCAGAGCGCAAGTGTGATTTCAGG
TTCTTGTCTCCAAAAGCGCGAGATACAGCTAGTTGACCATTCACTCTAGCAACATCTCCTGAGATAATAGGCATTTTAACACAGATGTAGAAACATATTC
CAAAATACAGTAATATTACGTAAAGTGCCACGTCTAGATCACATCTGCATAGTTTGGCACACTGAGGACAGCAGCGTAAATTCTAAATCTACATAAGAAC
AGGTCTGTTTGGTGCAAGAAGACCCTCGAATTCTTGCAAGGAAAAAGATTCTTCTATGTAACTTTTTCCCATCCAATTTATTTTTTTCTCTAAATAAATG
AAAGTTGATTCCAGGGTGAGGTACGAATAACCAACAACAGATCTAACACAGACACCCTATACATAGATGTCGGACCGCCAATCACAAAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.973946
Expected error %
1.10169
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g34750.1 Score 109 E Value 2e-24 Identity 16.80% Align. Length 374bp (47.40%) Frame 2
68414.m04321 protein phosphatase 2C, putative / PP2C, putative similar to GB:AAD17805 from (Lotus japonicus) (Proc. Natl. Acad. Sci. U.S.A. 96 (4), 1738-1743 (1999))
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g22280.1 Score 109 E Value 2e-24 Identity 16.30% Align. Length 380bp (48.16%) Frame 2
68414.m02786 protein phosphatase 2C, putative / PP2C, putative similar to protein phosphatase type 2C GI:4336436 from [Lotus japonicus]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAM91671.1| Score 109 E Value 9e-23 Identity 16.30% Align. Length 380bp (48.16%) Frame 2
putative protein phosphatase type 2C [Arabidopsis thaliana] gb|AAL86005.1| putative protein phosphatase type 2C [Arabidopsis thaliana] ref|NP_564165.1| protein phosphatase 2C, putative / PP2C, putative [Arabidopsis thaliana] pir||F86355 T16E15.10 protein - Arabidopsis thaliana gb|AAF87263.1| Strong similarity to protein phosphatase type 2C (PP2C2) from Lotus japonicus gb|AF092432 and contains a protein phosphatase 2C PF|00481 domain. EST gb|T46258 comes from this gene. [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_174731.1| Score 109 E Value 9e-23 Identity 16.80% Align. Length 374bp (47.40%) Frame 2
protein phosphatase 2C, putative / PP2C, putative [Arabidopsis thaliana] gb|AAD46006.1| Strong similarity to gb|AF092432 protein phosphatase type 2C from Lotus japonicus. EST gb|T76026 comes from this gene. [Arabidopsis thaliana] gb|AAK43927.1| protein phosphatase type 2C-like protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0052F03
Clone
Clone name
hba-52f3
LE_HBa0052F03
P052F03
Clone type
BAC
Contamination
none
Estimated length
98,980
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found