Clone Read LE_HBa0052M03_SP6_81604

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0052M03_SP6_81604
Primer
SP6
ID from Seq. Facility
LE_HBa_052_M03-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
715 trimmed for vector and quality, 747 raw
Sequence
>LE_HBa0052M03_SP6_81604 (raw untrimmed)
AAGCTTTGCCGCGTTACTTGACTCTTATAGATTTGTCAATCCAGTCTAAAGACCCAAATTCTGTTTGTGTTCCCTCTTATCTTTTATCAATAACTAGAGG
AAGATTGCTCCTTCCTTATTCCTTGTTTCTTAAAAATAAGTTGTGTTTCCTGTGCAACTGGACTTATTTTTCTTTTTCTTAGATCCTTTCCAATTTCACA
CAATCTTTGAACACTGCATCCATTCCCTTCTTTACTCATGTTGGTTTTTTATTGATAGCTATTGGTGCAATGAACTATTTTAAAAATTATCTATAATGGA
GGTTTATAAAGAACAATTTGTTGGTGCCTCGTGTTTTTTTTTTTCTTCTGTTTATCATAATTTCTGATCTTCAAGATAAATCTGAAACATCCTCATCATT
GTCAATGTTTTATCTTTCTATCATAACAGGCAGCATGGGTTGCAGGACAGTATGCCCATATAAACTTTGCAGATCCAAACAACTTCCGCAATGCATTACA
CAGTGTCGTGACTGGAATGCGTGATCCTGACCTACCTGTTCGTGTTGATTCTGTTTTTGCATTACGCTCGTTTATTGAAGCCTGCAAAGGTAAACATATA
CCTGACATTTTGGTATCTTCATATAGGTCAATCCTGCTTACACTTTTCATCTGTTTGTGCAGATTTGAATGAAATCCGACCAATTCTTCCTCAGCTACTT
GATGGTACTTGTGATATCCTTTGTGTTTTGTATTGCCAACCAACATC
>LE_HBa0052M03_SP6_81604 (trimmed for quality and cloning vector)
TGACTCTTATAGATTTGTCAATCCAGTCTAAAGACCCAAATTCTGTTTGTGTTCCCTCTTATCTTTTATCAATAACTAGAGGAAGATTGCTCCTTCCTTA
TTCCTTGTTTCTTAAAAATAAGTTGTGTTTCCTGTGCAACTGGACTTATTTTTCTTTTTCTTAGATCCTTTCCAATTTCACACAATCTTTGAACACTGCA
TCCATTCCCTTCTTTACTCATGTTGGTTTTTTATTGATAGCTATTGGTGCAATGAACTATTTTAAAAATTATCTATAATGGAGGTTTATAAAGAACAATT
TGTTGGTGCCTCGTGTTTTTTTTTTTCTTCTGTTTATCATAATTTCTGATCTTCAAGATAAATCTGAAACATCCTCATCATTGTCAATGTTTTATCTTTC
TATCATAACAGGCAGCATGGGTTGCAGGACAGTATGCCCATATAAACTTTGCAGATCCAAACAACTTCCGCAATGCATTACACAGTGTCGTGACTGGAAT
GCGTGATCCTGACCTACCTGTTCGTGTTGATTCTGTTTTTGCATTACGCTCGTTTATTGAAGCCTGCAAAGGTAAACATATACCTGACATTTTGGTATCT
TCATATAGGTCAATCCTGCTTACACTTTTCATCTGTTTGTGCAGATTTGAATGAAATCCGACCAATTCTTCCTCAGCTACTTGATGGTACTTGTGATATC
CTTTGTGTTTTGTAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.946753
Expected error %
0.321073
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g31660.1 Score 103 E Value 2e-27 Identity 87.00% Align. Length 276bp (38.60%) Frame 2
68415.m03865 importin beta-2 subunit family protein similar to D-Importin 7/RanBP7 [Drosophila melanogaster] GI:7542336; contains Pfam profile PF03810: Importin-beta N-terminal domain
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g59020.1 Score 86 E Value 2e-21 Identity 74.10% Align. Length 276bp (38.60%) Frame 2
68416.m06578 importin beta-2 subunit family protein similar to D-Importin 7/RanBP7 [Drosophila melanogaster] GI:7542336; contains Pfam profile PF03810: Importin-beta N-terminal domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_180724.2| Score 103 E Value 8e-26 Identity 87.00% Align. Length 276bp (38.60%) Frame 2
importin beta-2 subunit family protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD24843.1| Score 103 E Value 4e-21 Identity 29.00% Align. Length 161bp (22.52%) Frame 2
putative importin (nuclear transport factor ) protein [Arabidopsis thaliana] pir||E84723 hypothetical protein At2g31660 [imported] - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0052M03
Clone
Clone name
hba-52m3
LE_HBa0052M03
P052M03
Clone type
BAC
Contamination
none
Estimated length
66,952
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found