Clone Read LE_HBa0055E23_T7_82029

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0055E23_T7_82029
Primer
T7
ID from Seq. Facility
LE_HBa_055_E23-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
703 trimmed for vector and quality, 872 raw
Sequence
>LE_HBa0055E23_T7_82029 (raw untrimmed)
ATCATACTCGGTACCGGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTTAGGCTTCTTCGGCATCCAGCTATAGTGGAAATCAAGCATATAT
TGTTACCTCCTTCTCGGAGGGAATTCAAGGATATCTATGTTGTCTTTGAACTCATGGAATCTGATTTGCACCAAGTCATTAAAGCAAATGATGATCTGAC
GCCGGAACATTATCAATTTTTCCTTTATCAGCTTCTTCGAGGGCTGAAATATATACACACAGGTTGTATGCTGGCTAAAATTGTGCTTTAATTACTATGA
CTTTCTTCCACGAAGACCATATTTATGTATTTTGACATTAACATAGCCATATTAGCTGCAATGGTATGCTTCAATCCATGAAAGTTTCTCCAATTCTAAC
AATGCCTCTATGTTGGAATATTATGCAGCCAATGTCTTTCACCGTGACCTGAAACCCAAAAATATATTAGCAAATGCTGACTGCAAGCTTAAGATCTGTG
ACTTTGGTCTTGCAAGAGTGGCCTTCAATGATACTCCAACAGCTATATTTTGGACTGTATGCTTCTTAATGCTCTGCACAAAATTTATAACTTCGAAAAT
AGCTCTGTTTGAGATTAGAGGAACATGTAACATCTAATAACCTGGTTATTTGTTCCTGTAGGATTATGTTGCTACGAGGTGGTATAGGGCTCCTGAATTG
TGTGGATCATTTTTCTCTAAGGTGTGAATATACACTTTTTTGCTTTAGATAGTTAATCCGATTTATTGGTGAAACAGCTATAATTTCTTCATTTTATTAT
GAAAACACCACATTCTAAGATCAGTTATTGGGATTTGGTCTCAGTATCCCCCACCATTTGATATATGGAGCT
>LE_HBa0055E23_T7_82029 (trimmed for quality and cloning vector)
AGCTTCTTAGGCTTCTTCGGCATCCAGCTATAGTGGAAATCAAGCATATATTGTTACCTCCTTCTCGGAGGGAATTCAAGGATATCTATGTTGTCTTTGA
ACTCATGGAATCTGATTTGCACCAAGTCATTAAAGCAAATGATGATCTGACGCCGGAACATTATCAATTTTTCCTTTATCAGCTTCTTCGAGGGCTGAAA
TATATACACACAGGTTGTATGCTGGCTAAAATTGTGCTTTAATTACTATGACTTTCTTCCACGAAGACCATATTTATGTATTTTGACATTAACATAGCCA
TATTAGCTGCAATGGTATGCTTCAATCCATGAAAGTTTCTCCAATTCTAACAATGCCTCTATGTTGGAATATTATGCAGCCAATGTCTTTCACCGTGACC
TGAAACCCAAAAATATATTAGCAAATGCTGACTGCAAGCTTAAGATCTGTGACTTTGGTCTTGCAAGAGTGGCCTTCAATGATACTCCAACAGCTATATT
TTGGACTGTATGCTTCTTAATGCTCTGCACAAAATTTATAACTTCGAAAATAGCTCTGTTTGAGATTAGAGGAACATGTAACATCTAATAACCTGGTTAT
TTGTTCCTGTAGGATTATGTTGCTACGAGGTGGTATAGGGCTCCTGAATTGTGTGGATCATTTTTCTCTAAGGTGTGAATATACACTTTTTTGCTTTAGA
TAG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.963599
Expected error %
0.558619
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g19010.1 Score 141 E Value 4e-34 Identity 63.00% Align. Length 669bp (95.16%) Frame 1
68418.m02258 mitogen-activated protein kinase, putative / MAPK, putative (MPK16) mitogen-activated protein kinase (MAPK)(AtMPK16), PMID:12119167; similar to ATMPK9, Arabidopsis thaliana, EMBL:AB038694
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g18040.1 Score 138 E Value 3e-33 Identity 59.00% Align. Length 669bp (95.16%) Frame 1
68416.m02294 mitogen-activated protein kinase, putative / MAPK, putative (MPK9) identical to ATMPK9 [Arabidopsis thaliana] gi|7106544|dbj|BAA92223; mitogen-activated protein kinase (MAPK), PMID:12119167; similar to blast and wounding induced mitogen-activated protein kinase (BWMK1) GB:AAD52659 [Oryza sativa]; contains Pfam profile: PF00069 Eukaryotic protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_475603.1| Score 142 E Value 8e-33 Identity 61.00% Align. Length 669bp (95.16%) Frame 1
putative Mitogen-activated protein kinase [Oryza sativa (japonica cultivar-group)] gb|AAU90196.1| putative mitogen-activated protein kinase [Oryza sativa (japonica cultivar-group)] gb|AAS98446.1| putative Mitogen-activated protein kinase [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAX94956.1| Score 142 E Value 8e-33 Identity 62.00% Align. Length 669bp (95.16%) Frame 1
Protein kinase domain, putative [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0055E23
Clone
Clone name
hba-55e23
LE_HBa0055E23
C01HBa0055E23
P055E23
Clone type
BAC
Contamination
none
Estimated length
96,132
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found