Clone Read LE_HBa0055G03_T7_82085

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0055G03_T7_82085
Primer
T7
ID from Seq. Facility
LE_HBa_055_G03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
710 trimmed for vector and quality, 915 raw
Sequence
>LE_HBa0055G03_T7_82085 (raw untrimmed)
ATAACCCTGGTACCGAGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTCCCACTTAGCTATCAATTCCCTTTGGGTCATAATGTTTTCCGGTG
GTCTAAGGTACAGTGTCTTGTTCATTGTCCTTGGATCATCTATACTTTTTATAGTGTATGTTGCCACGTCATCTTCATCCATGTATACCACTGAATAAAA
ATAACCCAAATAAGAAAGAAAAAAAAAAGTTAAAAATTTCAAAATGTAAAAGGTACCCCATTAGTTTATTTTCTAAGACGATTAAAAGAATAATAACTTT
GTTATATTTTGATAACTATTTTCATTTTGATAATCCACCCTTTAATAACAGACATATATATAGAAATGTCGCTACTTCCATATCTTATGTTATTTTTCTA
TATAAATAAAAATATAGCTGGTTAAAATTAATTAATTTTTTATTTTTCCATTATTAAATTCTTTTTTAAACGGGTAACAACATTGATGACCTGTATATAC
ATATTATAAAGTTCTAAAAGGGTTTCTCTATTTTTTTTTAGTTTTGGTATTGATGTATAAGGTACCTAAATAGAGTGTACTTTAAAAAAGCTAAAAGGTA
GATTAGTAAAAATACTTTTTTTATTGATTATTTCTTTGAAGAACATGTAAAAAAAGAAATTAAATAATGGACACATATATAATATGACACAATTATCTAA
ATAGACAAGTAATATAAGAAAAAAAATATAACATATTAATTAAGATAAATTACAAGTTGTACAATATCTTAATTTAATAACCACAAAAGCCTCCTTTCTA
ATCTGGCTACGATCAAACACCATCAGGCATATCAAATATAAAATAAGAAATAATTTTTTTTTATTATAGAAAAGTACCTTAAAATTTGCCACTCCCAAGA
AAAACTTTGATTTTT
>LE_HBa0055G03_T7_82085 (trimmed for quality and cloning vector)
AGCTTTTCCCACTTAGCTATCAATTCCCTTTGGGTCATAATGTTTTCCGGTGGTCTAAGGTACAGTGTCTTGTTCATTGTCCTTGGATCATCTATACTTT
TTATAGTGTATGTTGCCACGTCATCTTCATCCATGTATACCACTGAATAAAAATAACCCAAATAAGAAAGAAAAAAAAAAGTTAAAAATTTCAAAATGTA
AAAGGTACCCCATTAGTTTATTTTCTAAGACGATTAAAAGAATAATAACTTTGTTATATTTTGATAACTATTTTCATTTTGATAATCCACCCTTTAATAA
CAGACATATATATAGAAATGTCGCTACTTCCATATCTTATGTTATTTTTCTATATAAATAAAAATATAGCTGGTTAAAATTAATTAATTTTTTATTTTTC
CATTATTAAATTCTTTTTTAAACGGGTAACAACATTGATGACCTGTATATACATATTATAAAGTTCTAAAAGGGTTTCTCTATTTTTTTTTAGTTTTGGT
ATTGATGTATAAGGTACCTAAATAGAGTGTACTTTAAAAAAGCTAAAAGGTAGATTAGTAAAAATACTTTTTTTATTGATTATTTCTTTGAAGAACATGT
AAAAAAAGAAATTAAATAATGGACACATATATAATATGACACAATTATCTAAATAGACAAGTAATATAAGAAAAAAAATATAACATATTAATTAAGATAA
ATTACAAGTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.891822
Expected error %
0.493754
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g13660.1 Score 71 E Value 7e-13 Identity 20.60% Align. Length 140bp (19.72%) Frame 1
68417.m02124 pinoresinol-lariciresinol reductase, putative similar to pinoresinol-lariciresinol reductase TH1 [Tsuga heterophylla][GI:7578915]; contains isoflavone reductase domain PF02716
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g32100.1 Score 70 E Value 1e-12 Identity 19.90% Align. Length 140bp (19.72%) Frame 1
68414.m03950 pinoresinol-lariciresinol reductase, putative similar to pinoresinol-lariciresinol reductase TH1 [Tsuga heterophylla][GI:7578915]; contains isoflavone reductase domain PF02716
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAB67729.1| Score 87 E Value 4e-16 Identity 27.50% Align. Length 137bp (19.30%) Frame 1
isoflavone reductase-like protein pir||T11035 probable 2'-hydroxyisoflavone reductase (EC 1.3.1.45) - white lupine sp|P52581|IFRI_LUPAL Isoflavone reductase homolog
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAF64184.1| Score 76 E Value 7e-13 Identity 22.50% Align. Length 137bp (19.30%) Frame 1
pinoresinol-lariciresinol reductase TH1 [Tsuga heterophylla]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0055G03
Clone
Clone name
hba-55g3
LE_HBa0055G03
P055G03
Clone type
BAC
Contamination
none
Estimated length
72,730
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found