Clone Read LE_HBa0055G23_SP6_82124

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0055G23_SP6_82124
Primer
SP6
ID from Seq. Facility
LE_HBa_055_G23-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
307 trimmed for vector and quality, 748 raw
Sequence
>LE_HBa0055G23_SP6_82124 (raw untrimmed)
TCCTTTTGGGAAAATAGATTGCTTGATCGCGAATTCTTCGGTGGAGGTAGGTTATGGTTTTTACACTATTCCTTTTAAACTTTTAATAGCGAATGATATG
TATTGGATAGTGTCTTAAACCCTTCTACATGCTTAATTGTGTGTTTACATGTTGTGATTATATAATTGTGATGAGATAAGCATGATGATTCTATTGAATT
CTAAATCTTGAAAAAGAAACCCTAATCTACTTTGTTAATGATGATGCCTTAGTATAAAAGAAGGCTTGATGAACGAAAGTAGTGAGATTAGGGGATCGGG
TGCCACGTTCCGGTACCAGGATAGTATATGATGTATTTACTCGTCTCTTTCCTATACCCGGATAGTATATGGATCGGGTGCCACGTTCCGGTACCAGGAT
AGAATATGGATCGGGTGTCACGTTCCTACACCATGATAGAATGAGGATCGGACTGTCACGTTCCGATACTTTTTTAGAATCCCGACGAGCGCATTGTCTC
TTCCCGACACATAAAGAAATAAAGTATTTGTATTACGTTAGATGTTGTATTTTCCTATCTATTCAACCTATCCTACTTATATTCCACGATCACTGTGGTG
GCGTTATCCTTTTATTGAAATGCATTTTTATCGCGATAAGACTATTCGTTACTCCTAACTTCCCTGTCTCTACAGCATTTTACTTTGATTATTTCTTATG
TTTCTCTATTTTTCCTTTATATTTTATAAGAGTAGTAAAACATTATAA
>LE_HBa0055G23_SP6_82124 (trimmed for quality and cloning vector)
ATTGCTTGATCGCGAATTCTTCGGTGGAGGTAGGTTATGGTTTTTACACTATTCCTTTTAAACTTTTAATAGCGAATGATATGTATTGGATAGTGTCTTA
AACCCTTCTACATGCTTAATTGTGTGTTTACATGTTGTGATTATATAATTGTGATGAGATAAGCATGATGATTCTATTGAATTCTAAATCTTGAAAAAGA
AACCCTAATCTACTTTGTTAATGATGATGCCTTAGTATAAAAGAAGGCTTGATGAACGAAAGTAGTGAGATTAGGGGATCGGGTGCCACGTTCCGGTACC
AGGATAG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.931325
Expected error %
0.576687
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0055G23
Clone
Clone name
hba-55g23
LE_HBa0055G23
P055G23
Clone type
BAC
Contamination
none
Estimated length
109,186
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found