Clone Read LE_HBa0055G23_T7_82125

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0055G23_T7_82125
Primer
T7
ID from Seq. Facility
LE_HBa_055_G23-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
705 trimmed for vector and quality, 893 raw
Sequence
>LE_HBa0055G23_T7_82125 (raw untrimmed)
GACCACCTGGGTCCCGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATGTGATTGTACCATGATAAGTACTTTCAAGTAGCAGACAAGATAAG
ACCTCTTATGTGGGAACCTTCAAATTACCTTTGTTTCCTCTTCTTTCAAGAAATTCAAAAGATCATACCTGATTAGGAATCCTATGAGCAAAAGAAGTAC
ACACTTGATAACTATATACATAAAAGCTAAAAGTTCTGAATTTAAAAATATGTCCACCTCTTTAGAATTCGAATTCAAAATTTATACTGCATAAGGTACA
AGTAGTTATGTTAGCATACCTTCCTCTTCATTTCTTTCAGCATATCTTCAAGCCCTGCACGCTGAGCGCCAAGACCTTCTAATTGTCTCTGCAAATATAA
GCACCAAAATATAATAGTCTGTGGAGGCGGTTATTTTAATTATTTTTTATGAAATAAGTTTATAGAAACAGTTATTATGGGTGCAACTTAAAGAATGTTC
ATCCAATAAATAAAATATCCCCCAAATAGATCCAACAGAAGTCGGGAACTTTGTCTTCCACAGTCCATAAATTCAATCTTCTTTTTATTTTTAACCGGTA
AAGGATAAGTATATTGATTAACAGCACAAGTGAGCACTGGAGAATATGCACAGTTAACATCATTGCAACTTTGTTAAAGGTGCTAAAAAAATCCATCCCG
GCTTCAGCATCATTAAAAGAGGCTGGTATTTGCACCCCAAAAAAAGGTGTTGAAGAACATCTGTAATTCCCAAAACAAGCAGTCCTTTTCTACTCCCAAA
AATAAACGGGCTTTTTGTTCCATGCCTTCCTGTGGACCACAGAAGAATTCCCCCTTTTTTTTTCAAACCATTATCTTATTCTTATCCGGTTTG
>LE_HBa0055G23_T7_82125 (trimmed for quality and cloning vector)
AGCTTATGTGATTGTACCATGATAAGTACTTTCAAGTAGCAGACAAGATAAGACCTCTTATGTGGGAACCTTCAAATTACCTTTGTTTCCTCTTCTTTCA
AGAAATTCAAAAGATCATACCTGATTAGGAATCCTATGAGCAAAAGAAGTACACACTTGATAACTATATACATAAAAGCTAAAAGTTCTGAATTTAAAAA
TATGTCCACCTCTTTAGAATTCGAATTCAAAATTTATACTGCATAAGGTACAAGTAGTTATGTTAGCATACCTTCCTCTTCATTTCTTTCAGCATATCTT
CAAGCCCTGCACGCTGAGCGCCAAGACCTTCTAATTGTCTCTGCAAATATAAGCACCAAAATATAATAGTCTGTGGAGGCGGTTATTTTAATTATTTTTT
ATGAAATAAGTTTATAGAAACAGTTATTATGGGTGCAACTTAAAGAATGTTCATCCAATAAATAAAATATCCCCCAAATAGATCCAACAGAAGTCGGGAA
CTTTGTCTTCCACAGTCCATAAATTCAATCTTCTTTTTATTTTTAACCGGTAAAGGATAAGTATATTGATTAACAGCACAAGTGAGCACTGGAGAATATG
CACAGTTAACATCATTGCAACTTTGTTAAAGGTGCTAAAAAAATCCATCCCGGCTTCAGCATCATTAAAAGAGGCTGGTATTTGCACCCCAAAAAAAGGT
GTTGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.948769
Expected error %
1.23085
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0055G23
Clone
Clone name
hba-55g23
LE_HBa0055G23
P055G23
Clone type
BAC
Contamination
none
Estimated length
109,186
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found