Clone Read LE_HBa0055N09_SP6_82432

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0055N09_SP6_82432
Primer
SP6
ID from Seq. Facility
LE_HBa_055_N09-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
666 trimmed for vector and quality, 795 raw
Sequence
>LE_HBa0055N09_SP6_82432 (raw untrimmed)
AACAGCTACTCTGCAGATCCAGTTGACGACAAGCTGTCAGTTTTAGCAGAAAGTAATGAAAGAGCAACAGAATCGAGTTTTGGTGGTGGTGCATTGGAGG
GCCTTCCACCAAGGCGCATGGATGGCCAGGATTATGCTGCTGCAGCTGGTGGTAGATGGCAGGACTTCTCCTTCTCACAAGGCAGGCACGGTAGCCGTGG
TGGCCGAACAGGGTATGCCGGTAGTAGATCAACTTCTGGTCAAACATCGAGGGACCGTACTAATCAGGCACGAGGGACTCTTGGGGGTCAAGGCTCAAGA
TATCAGAGTGGTACAACCTCCAGGGGAAGCCAGATGGATGGTTCAGGTCGCATGGTTAATCTTAACAGAGGGGGTCGTTCTTAGAGAGAGACGTGCACAA
TTTTTGCATAGGAAGAATCACATATCTTGAGGGTTCCTTGTTGTAGTAGAGTTTACAGTTTTCTTTGTTTCATAGACCAACTTTCATTGTGCTACATTGT
TTTGTGACTTTGTAGAGCATCTTTTGGATGTTGCACTGCTTTTCTCATTTAATGACACAACAATTCCTTTTAAATGTAATTTGCATCAAATATTCGCTCC
TAATACATACACACTAGAGTATTGTCTTTGCTAGATGTTGCTGCACAAATCTCGTAACAGATACACATTACAGTCTGCTAATACCAATATGCTCACTGAG
TTGATTTTTTACACCCCAGCAATAGCTATTGAATAGATTGAATTGATTAAGTATACCGTATTTATAAAGATCTTTGAAATAACAAACAAACGCCC
>LE_HBa0055N09_SP6_82432 (trimmed for quality and cloning vector)
GCTGTCAGTTTTAGCAGAAAGTAATGAAAGAGCAACAGAATCGAGTTTTGGTGGTGGTGCATTGGAGGGCCTTCCACCAAGGCGCATGGATGGCCAGGAT
TATGCTGCTGCAGCTGGTGGTAGATGGCAGGACTTCTCCTTCTCACAAGGCAGGCACGGTAGCCGTGGTGGCCGAACAGGGTATGCCGGTAGTAGATCAA
CTTCTGGTCAAACATCGAGGGACCGTACTAATCAGGCACGAGGGACTCTTGGGGGTCAAGGCTCAAGATATCAGAGTGGTACAACCTCCAGGGGAAGCCA
GATGGATGGTTCAGGTCGCATGGTTAATCTTAACAGAGGGGGTCGTTCTTAGAGAGAGACGTGCACAATTTTTGCATAGGAAGAATCACATATCTTGAGG
GTTCCTTGTTGTAGTAGAGTTTACAGTTTTCTTTGTTTCATAGACCAACTTTCATTGTGCTACATTGTTTTGTGACTTTGTAGAGCATCTTTTGGATGTT
GCACTGCTTTTCTCATTTAATGACACAACAATTCCTTTTAAATGTAATTTGCATCAAATATTCGCTCCTAATACATACACACTAGAGTATTGTCTTTGCT
AGATGTTGCTGCACAAATCTCGTAACAGATACACATTACAGTCTGCTAATACCAATATGCTCACTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.980264
Expected error %
0.770753
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g56150.1 Score 95 E Value 4e-20 Identity 18.70% Align. Length 347bp (52.10%) Frame 3
68416.m06241 eukaryotic translation initiation factor 3 subunit 8 / eIF3 p110 / eIF3c / p105 (TIF3C1) nearly identical to SP|O49160 Eukaryotic translation initiation factor 3 subunit 8 (eIF3 p110) (eIF3c) (p105) {Arabidopsis thaliana}
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAL13083.1| Score 105 E Value 8e-22 Identity 21.00% Align. Length 347bp (52.10%) Frame 3
putative translation-initiation factor 3 subunit [Prunus avium]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD39891.1| Score 104 E Value 2e-21 Identity 20.10% Align. Length 347bp (52.10%) Frame 3
putative translation initiation protein [Medicago truncatula] sp|Q9XHM1|IF38_MEDTR Eukaryotic translation initiation factor 3 subunit 8 (eIF3 p110) (eIF3c) pir||T50774 probable translation initiation factor [imported] - barrel medic
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0055N09
Clone
Clone name
hba-55n9
LE_HBa0055N09
P055N09
Clone type
BAC
Contamination
none
Estimated length
113,069
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found