Clone Read LE_HBa0060E05_SP6_82760

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0060E05_SP6_82760
Primer
SP6
ID from Seq. Facility
LE_HBa_060_E05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
585 trimmed for vector and quality, 797 raw
Sequence
>LE_HBa0060E05_SP6_82760 (raw untrimmed)
TAATTTTGTTCCCCCAATCTCAAACTTAATTTTAATTTTTCTTTCTTTAATCCAAGACTTGATCTCAGATTCTATAAATCTTCAAATTTGAGAGGTTTTG
TAAAGATATCCGCAATTTAATCATGAGATTTCACATACTTGAACTCTATCTCTTTCATGGAAATGCATTCTTGAATAAAGTGATACCTTGTGTCTATGTG
CTTGCTCCAATCATGATACACTAAATTCTTGGCAACTACCGGTCGCGCAAAGTTGTTATCAATACATAAATGGAGTTCCTTCAACAATCTCCCTTACTAA
ATAGCATGACATGTACATGATGTCGTTGCCACATATTTAACTTCACAAGTCTCAGAGAGTAAAAATTGATTGTTTCTTTGAACTTTAAGAAATAACACAA
TCACCTTAGAAAAATACCAAATCAGATGTACTTTTTCTATCATTAATAATGTCTCCCGCATAATCACCATTATAGTATCCCACAATGTTAAAATCATCAG
AATTAGAATAAAAATGTCCAAAATCGACTGTACCTTTTAGGTAACATGGAATTATTCTCGTGACCTTCAAGTGAGTGAAGGTAGAAGCTTCCATAAATGA
CTTACCTACTCTAACCACAAAATATATACCCGCCCTCATACATGTAAGTATCTTAAACTTTCTACTGTACTTTTGAACAGATTGGAATCTACCTTTTCTC
AATTTTTAAACTTTTAAAATTTTTAATTTCCTTTCCTTTGGGGTGTTCAAATAGATATTATACAATTTATTTAAATTTTTTAAAATCGTTTTTTGTT
>LE_HBa0060E05_SP6_82760 (trimmed for quality and cloning vector)
ATTTTAATTTTTCTTTCTTTAATCCAAGACTTGATCTCAGATTCTATAAATCTTCAAATTTGAGAGGTTTTGTAAAGATATCCGCAATTTAATCATGAGA
TTTCACATACTTGAACTCTATCTCTTTCATGGAAATGCATTCTTGAATAAAGTGATACCTTGTGTCTATGTGCTTGCTCCAATCATGATACACTAAATTC
TTGGCAACTACCGGTCGCGCAAAGTTGTTATCAATACATAAATGGAGTTCCTTCAACAATCTCCCTTACTAAATAGCATGACATGTACATGATGTCGTTG
CCACATATTTAACTTCACAAGTCTCAGAGAGTAAAAATTGATTGTTTCTTTGAACTTTAAGAAATAACACAATCACCTTAGAAAAATACCAAATCAGATG
TACTTTTTCTATCATTAATAATGTCTCCCGCATAATCACCATTATAGTATCCCACAATGTTAAAATCATCAGAATTAGAATAAAAATGTCCAAAATCGAC
TGTACCTTTTAGGTAACATGGAATTATTCTCGTGACCTTCAAGTGAGTGAAGGTAGAAGCTTCCATAAATGACTTACCTACTCTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.940992
Expected error %
0.337537
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAG60117.1| Score 124 E Value 1e-27 Identity 53.70% Align. Length 567bp (96.92%) Frame 3
copia-type polyprotein, putative [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAG50765.1| Score 124 E Value 2e-27 Identity 53.70% Align. Length 567bp (96.92%) Frame 3
copia-type polyprotein, putative [Arabidopsis thaliana] gb|AAG50698.1| copia-type polyprotein, putative [Arabidopsis thaliana] pir||F96614 probable copia-type polyprotein T18I24.5 [imported] - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0060E05
Clone
Clone name
hba-60e5
LE_HBa0060E05
P060E05
Clone type
BAC
Contamination
none
Estimated length
115,537
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found