Clone Read LE_HBa0060E05_T7_82761

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0060E05_T7_82761
Primer
T7
ID from Seq. Facility
LE_HBa_060_E05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
607 trimmed for vector and quality, 894 raw
Sequence
>LE_HBa0060E05_T7_82761 (raw untrimmed)
ATTTTTTGGTACCGGGGGATTCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCACCGTCATTAAGGTATAGTTCCATCATTAAGCATAATTGAATCGACA
AATCAACTTGGATTGCTGTAAAATTGATTTTTATTTTTGTTCAATTGATTTGAATTGAAAAAATATTCGATCAAGTTTTACTTGATTTGATATTAACAAA
AAAAAAAAGTTAAATCAAATTCAAATCAAATGAATATATATATAAAAAGTTTAATTATAAGGAACTTAGTAAGTATGTTTTAGATTAGTTTACAACCTTC
CATATTTGATACTTTTGTTGTCTCAATTTATATGACACATCTTATATTTTGAGAGTAAAAAAGTTTAAGTTTGACCATAAATTTGAGCATGAAATCTTCA
AAAAAAAATTAATAAAATTTATATATTTGTAAAGTACGTAAAAAGTACTACGAGTCACAATAATTGATAATTTAAAATATTTTTAAAAATCTATAAAAAA
TTTACGGTCAAACATAGACTTATTGTCTCTTGAAATCCGAAAAATAATATATAAAATGGGACGAAAGTACTATATTATTTCATATTTGAGCCTGGAATAT
GACCCCNCACCTCGATATTTGTTGTGTCTTTTCATATGTTTATAATATATGGTCCTAGGGGCGGAATTCCATGTATTATTTTGTCTGTCCTTCACTTTGT
TAACTTTAAAAAATATTGTATATATATTAAGTTTCTATCCTTTAACTTATATTCCTTTTGTGATGTACCTATAATTCTAAATCTTATTTGTTTTCTTCTA
ACTTCCATAGTATATTCAGTCAATTCATCCTACATGTTACTACCATTTTTGCAGCATAATTCCAACCACAATTCTTTCCTTTTCTTTTTCTTAT
>LE_HBa0060E05_T7_82761 (trimmed for quality and cloning vector)
AGCTTCACCGTCATTAAGGTATAGTTCCATCATTAAGCATAATTGAATCGACAAATCAACTTGGATTGCTGTAAAATTGATTTTTATTTTTGTTCAATTG
ATTTGAATTGAAAAAATATTCGATCAAGTTTTACTTGATTTGATATTAACAAAAAAAAAAAGTTAAATCAAATTCAAATCAAATGAATATATATATAAAA
AGTTTAATTATAAGGAACTTAGTAAGTATGTTTTAGATTAGTTTACAACCTTCCATATTTGATACTTTTGTTGTCTCAATTTATATGACACATCTTATAT
TTTGAGAGTAAAAAAGTTTAAGTTTGACCATAAATTTGAGCATGAAATCTTCAAAAAAAAATTAATAAAATTTATATATTTGTAAAGTACGTAAAAAGTA
CTACGAGTCACAATAATTGATAATTTAAAATATTTTTAAAAATCTATAAAAAATTTACGGTCAAACATAGACTTATTGTCTCTTGAAATCCGAAAAATAA
TATATAAAATGGGACGAAAGTACTATATTATTTCATATTTGAGCCTGGAATATGACCCCNCACCTCGATATTTGTTGTGTCTTTTCATATGTTTATAATA
TATGGTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.891542
Expected error %
1.76928
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0060E05
Clone
Clone name
hba-60e5
LE_HBa0060E05
P060E05
Clone type
BAC
Contamination
none
Estimated length
115,537
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found