Clone Read LE_HBa0060G11_SP6_82868

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0060G11_SP6_82868
Primer
SP6
ID from Seq. Facility
LE_HBa_060_G11-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
418 trimmed for vector and quality, 758 raw
Sequence
>LE_HBa0060G11_SP6_82868 (raw untrimmed)
TTTTTTTTGAGGGTGGGCAAAAGTCACCAAGAAACGCAACGAAGAAGACATTTTTATCTTGCAGCCTAGTCTTTGAAAGATAAAATATCTCGACAAGACT
TGAAGAAGGGGGCATTGTCGTCACTTTTAATTTATTAAATATAAATATATAAAGTTGTTCGTGTTATAAAACTATAGAATAAGAAGAAGAAACTAGAGAG
AAAAGAAGATAAGACTTGTTATTTCTCTTTATGAATAAATTTACAATGAAGAGGAGCACTCTATTTATAGGAGAAATCTAACTTGGTCCCTAAGTTCGAC
TCTCTAACCATATCCTAAAAAGGACTCCAAATGATAGACATTCACTATAATACAAATACTATACAACACTCCCCCTGAATGTCTAATTCATAGATGATGT
GCCTCGTCAAATACCTTACTAAAAATATTTTAAGAAAATAAAAACTCTAGTAAAGGAAAAGAGTACACATATCTATTAATACGCATTCTAGATTGCCTCC
CTAAAAACCTTACAAGGAAAACCCAGTGGGACAAAACCGCGCAAGGGAAAAAGAGTATAACGCGTAATATCTTCTTCTCCCCGCCGATTTATCTAAAAAT
TTGAATTCTTTTGTTTGCGAGGTTGTGTAATGTCTTGTTGAAAGTTGATATTGGTAGATGCTTTTGGTTTAACCCTGCGGCCAGCCTGTCTTCTGATCGG
TACTCGTTGCCGTCGAATGGCCATAATTCTAGTGGGATTGTTGGGCGATGAGCGTACG
>LE_HBa0060G11_SP6_82868 (trimmed for quality and cloning vector)
GCCTAGTCTTTGAAAGATAAAATATCTCGACAAGACTTGAAGAAGGGGGCATTGTCGTCACTTTTAATTTATTAAATATAAATATATAAAGTTGTTCGTG
TTATAAAACTATAGAATAAGAAGAAGAAACTAGAGAGAAAAGAAGATAAGACTTGTTATTTCTCTTTATGAATAAATTTACAATGAAGAGGAGCACTCTA
TTTATAGGAGAAATCTAACTTGGTCCCTAAGTTCGACTCTCTAACCATATCCTAAAAAGGACTCCAAATGATAGACATTCACTATAATACAAATACTATA
CAACACTCCCCCTGAATGTCTAATTCATAGATGATGTGCCTCGTCAAATACCTTACTAAAAATATTTTAAGAAAATAAAAACTCTAGTAAAGGAAAAGAG
TACACATATCTATTAATA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.915445
Expected error %
1.1194
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0060G11
Clone
Clone name
hba-60g11
LE_HBa0060G11
C02HBa0060G11
P060G11
Clone type
BAC
Contamination
none
Estimated length
142,618
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found