Clone Read LE_HBa0060J02_T7_82995

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0060J02_T7_82995
Primer
T7
ID from Seq. Facility
LE_HBa_060_J02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
809 trimmed for vector and quality, 858 raw
Sequence
>LE_HBa0060J02_T7_82995 (raw untrimmed)
CTAAACTGGGCCCCGGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTAGCTAATTTTTGTATATATCCTTTATAGGTTCTTCATACAAATTT
ATCATCTTTGGAAAATATTAGAACTATTATTTATATAGTGTAAGAAAAAAAAAACTTTTAAAAATAATTAAGGATAGGATCTCTATCTTAGCTAATATAT
GAATACTCAACAAAAGAATTCTTTTTGCTTGAATTGACTTATTTAAGAAATTAGGTTTGTTACGTTTACAGACTATTTAATTTACATAAATTTCCTTTGC
CATACTCAAATATAATGAAAATAGTGAACAAAATTCATATATTAGAGATGAGTAATGGATGGTTAGTCATTCTAATATTTCCTGAAATGATTTAGTGTGA
AAAGAAATATATACCTATACTAAAAATATGTAAAGAGAGTTATTCATTCAACCTTTTTCCAAAAATGATTTTGTGAATATATTTTATTTTTAATCTTTGA
ATCGCATGTTAATAACATGAAGCTAAAAGTAATAATATGAAATAAAAAAGTAAAATAATAAAGATTTTTTTCTATTAACAAAGTGTATCTTAATATGTAT
AATTTTTCAATTAGACAATCATCACCAATTTTGTTAACATTTGGCTGCCACTTGGCAACATTTCTTGCTCCTACTCTTACTATATAAGATTTTCCTTTTA
AGTAAATTTATCATTAAACTTAGGCGGATCTTTCCTTACAATGCATTTTTTTGTCTTTTCCTTAAATAGTGAAGCACTCCTTTTCCTTTTCTCTTTCAAT
TTTAATTGAAAATCATTTTCTCCCTGGTGGAATACCCCCTTTTTTTTTTTTTTTTTTT
>LE_HBa0060J02_T7_82995 (trimmed for quality and cloning vector)
AGCTTTAGCTAATTTTTGTATATATCCTTTATAGGTTCTTCATACAAATTTATCATCTTTGGAAAATATTAGAACTATTATTTATATAGTGTAAGAAAAA
AAAAACTTTTAAAAATAATTAAGGATAGGATCTCTATCTTAGCTAATATATGAATACTCAACAAAAGAATTCTTTTTGCTTGAATTGACTTATTTAAGAA
ATTAGGTTTGTTACGTTTACAGACTATTTAATTTACATAAATTTCCTTTGCCATACTCAAATATAATGAAAATAGTGAACAAAATTCATATATTAGAGAT
GAGTAATGGATGGTTAGTCATTCTAATATTTCCTGAAATGATTTAGTGTGAAAAGAAATATATACCTATACTAAAAATATGTAAAGAGAGTTATTCATTC
AACCTTTTTCCAAAAATGATTTTGTGAATATATTTTATTTTTAATCTTTGAATCGCATGTTAATAACATGAAGCTAAAAGTAATAATATGAAATAAAAAA
GTAAAATAATAAAGATTTTTTTCTATTAACAAAGTGTATCTTAATATGTATAATTTTTCAATTAGACAATCATCACCAATTTTGTTAACATTTGGCTGCC
ACTTGGCAACATTTCTTGCTCCTACTCTTACTATATAAGATTTTCCTTTTAAGTAAATTTATCATTAAACTTAGGCGGATCTTTCCTTACAATGCATTTT
TTTGTCTTTTCCTTAAATAGTGAAGCACTCCTTTTCCTTTTCTCTTTCAATTTTAATTGAAAATCATTTTCTCCCTGGTGGAATACCCCCTTTTTTTTTT
TTTTTTTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.878004
Expected error %
1.6121
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0060J02
Clone
Clone name
hba-60j2
LE_HBa0060J02
P060J02
Clone type
BAC
Contamination
none
Estimated length
125,397
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found