Clone Read LE_HBa0004B08_T7_831

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0004B08_T7_831
Primer
T7
ID from Seq. Facility
LE_Hba_004_B08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
880 trimmed for vector and quality, 1197 raw
Genbank Accession
Sequence
>LE_HBa0004B08_T7_831 (raw untrimmed)
CTAGACGCGGTACCGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTTTTAGCACATGATGTTTACTTCCTTTTGCGGAACGAAACGTTGTAG
ACTTATAGAGCAATTTACTTTGCCGTTCTGGCCTGTGGGATTAGATTCCCGCATTCAGTAGACATGACGATGAGTATATTGTTATTTTTCGTGTGGTTAC
ATTGCTCAATGTAGCAAGATTTAAGTACTTTTTTACCAATTGTTGGTACTATTTTGCAAATCTAAACTCTTCCATTGCTGTGCTTCTCTTTGGTTTATGT
GACAATATGTTAGGTAGTAATGACAGAGTTCTTTGAGCTTCAAAATGGCTTTAGAGCTAACATGGTGCTCCTTGGTTAGATGTGCAACATATCGGTGAAT
GTCATATATGATCGAGATAATAGTGCCTTCAATCACATGAAACGACGAGAGTTAGTTGCTACGAAAAAGGTTCAACATAAATACTAGTAGAAATAGTGAA
TTGTGTGATTGATATAATATTCCGTTCCTGAAAGCAACATATCGTTGAATGTAACATGTGGTCGAGAAAATAATGCCTACAATCACATGAAACCTCGAGA
GCTAGTTGCTATGAAAAAGGTAGAATATATATACTAGTAGAAATAGTGAAATTGATAAAGTTCCGTGGAGTTCATAAATGCATAATGAATAAAGATCCTG
AATTTGTTAGAAAATTACTTCAAAGTAGTGGATATAGTATTAGTTTAATCACAATTCCAATCTACAAATTGCAATTAAATTTATAAGAAAATTAGTTCAA
GTGGGAAAACTATAGTAGATGAGCTTTCAATAATTTAATCATAGATCCCATCCTACAATAACAAATTACTTCCTATTACACTTTTATATTCGAAATTTAC
TAGTTCGATTTATCTGATTTCACATCAAATAAGCTCATTATAGGAAAAACAAGCTTTCTATCCAAAAATTACTTCATTTCTACAATTCTAATACAAGAAC
CTTCTCCGCCCATTCCTTGATGGGTTATGAAATTGTTATACAAAAAACATTACCGTGAAGCTTTCATTCATCCCTGCCTTTACAGGGAAAAAATATAGAA
TCCTTTTTTGTGGATAAGGAAATAATTTATTTTTCAAATTTTACCCGATAATATGTAATTATAAAAAATATTATATTTTAAATAGACGTTTTAAAAA
>LE_HBa0004B08_T7_831 (trimmed for quality and cloning vector)
AGCTTTTTTTAGCACATGATGTTTACTTCCTTTTGCGGAACGAAACGTTGTAGACTTATAGAGCAATTTACTTTGCCGTTCTGGCCTGTGGGATTAGATT
CCCGCATTCAGTAGACATGACGATGAGTATATTGTTATTTTTCGTGTGGTTACATTGCTCAATGTAGCAAGATTTAAGTACTTTTTTACCAATTGTTGGT
ACTATTTTGCAAATCTAAACTCTTCCATTGCTGTGCTTCTCTTTGGTTTATGTGACAATATGTTAGGTAGTAATGACAGAGTTCTTTGAGCTTCAAAATG
GCTTTAGAGCTAACATGGTGCTCCTTGGTTAGATGTGCAACATATCGGTGAATGTCATATATGATCGAGATAATAGTGCCTTCAATCACATGAAACGACG
AGAGTTAGTTGCTACGAAAAAGGTTCAACATAAATACTAGTAGAAATAGTGAATTGTGTGATTGATATAATATTCCGTTCCTGAAAGCAACATATCGTTG
AATGTAACATGTGGTCGAGAAAATAATGCCTACAATCACATGAAACCTCGAGAGCTAGTTGCTATGAAAAAGGTAGAATATATATACTAGTAGAAATAGT
GAAATTGATAAAGTTCCGTGGAGTTCATAAATGCATAATGAATAAAGATCCTGAATTTGTTAGAAAATTACTTCAAAGTAGTGGATATAGTATTAGTTTA
ATCACAATTCCAATCTACAAATTGCAATTAAATTTATAAGAAAATTAGTTCAAGTGGGAAAACTATAGTAGATGAGCTTTCAATAATTTAATCATAGATC
CCATCCTACAATAACAAATTACTTCCTATTACACTTTTATATTCGAAATTTACTAGTTCGATTTATCTGATTTCACATCA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.950922
Expected error %
1.24811
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0004B08
Clone
Clone name
hba-4b8
LE_HBa0004B08
C12HBa0004B08
P004B08
Clone type
BAC
Contamination
none
Estimated length
119,123
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found