Clone Read LE_HBa0040F08_SP6_8318

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0040F08_SP6_8318
Primer
SP6
ID from Seq. Facility
LE_HBa_040_F08-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
612 trimmed for vector and quality, 800 raw
Genbank Accession
Sequence
>LE_HBa0040F08_SP6_8318 (raw untrimmed)
AAATTTTTTTCTACAGCCTTTTNCCAGTGGGAAGGTAAGAGTTTCATTGTCTATTATGATGCATCCTATTCGGGTTTGGGTGCAGTATTAATGCAAGAGA
AGAATGTAATTGCTTATGCTTCAAGGCAATTAAAGGTGGACGAACGTAACTATCCAACTCATGATTTGGAATTGGCCGCGGTAGTGTTTGCATTAAAGCA
ATGGAGACACTATTTATATGGGGTTAAGTGTGAGGTCTATACGGATCATCGTAGCCTACAGTATGTCTTTACTTAGAAAGATTTGAACTTGAGACAGAGG
AGATGGATGGAACTACTGAAGGCTACGACATCACTATTTTGTATCATCCGGGGAAGGCGAATGTTGTAGCGGATGCTATAAGTAGAAAGGCGGGAAGCAT
GGGAAGTCTAGCTCACTTGCAAGCTTCTAGACGCCCATTGGCTAGAGAAGTTCAGATTCTGGCTAACGACCTTATGAGATTAGAAGTAAATGAGAAGGGA
GGATTTTTAGCTTGTGTGGAGGCAAGATCTTCCTTCCTTGACAAGATTAAGGGAAAGTAGTTTAATGATGAAAAAATGATCCGATCTGAGATAAAGTGTT
GCAAGGAGAGGCTAAAGAAGCGACAATCGATGAGGGAGGTGTTTTGAGGATTAAGGGAAGGGTATGTGTACCCCGCGTCGATGATTTGATCAACACTATT
CTGACAGAAGCTCATAGTTTCAAGGTATTCAATACTTCCGGGGGGCACCAAGATGTTACCGTGACCTAAAGCACCCTTTTTTGGGGGGAACTAGCATTAA

>LE_HBa0040F08_SP6_8318 (trimmed for quality and cloning vector)
AAGGTAAGAGTTTCATTGTCTATTATGATGCATCCTATTCGGGTTTGGGTGCAGTATTAATGCAAGAGAAGAATGTAATTGCTTATGCTTCAAGGCAATT
AAAGGTGGACGAACGTAACTATCCAACTCATGATTTGGAATTGGCCGCGGTAGTGTTTGCATTAAAGCAATGGAGACACTATTTATATGGGGTTAAGTGT
GAGGTCTATACGGATCATCGTAGCCTACAGTATGTCTTTACTTAGAAAGATTTGAACTTGAGACAGAGGAGATGGATGGAACTACTGAAGGCTACGACAT
CACTATTTTGTATCATCCGGGGAAGGCGAATGTTGTAGCGGATGCTATAAGTAGAAAGGCGGGAAGCATGGGAAGTCTAGCTCACTTGCAAGCTTCTAGA
CGCCCATTGGCTAGAGAAGTTCAGATTCTGGCTAACGACCTTATGAGATTAGAAGTAAATGAGAAGGGAGGATTTTTAGCTTGTGTGGAGGCAAGATCTT
CCTTCCTTGACAAGATTAAGGGAAAGTAGTTTAATGATGAAAAAATGATCCGATCTGAGATAAAGTGTTGCAAGGAGAGGCTAAAGAAGCGACAATCGAT
GAGGGAGGTGTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.964379
Expected error %
0.0322344
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 156 E Value 2e-60 Identity 77.10% Align. Length 547bp (89.38%) Frame 1
putative polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA73042.1| Score 155 E Value 6e-46 Identity 76.00% Align. Length 544bp (88.89%) Frame 1
polyprotein [Ananas comosus] pir||T07863 probable polyprotein - pineapple retrotransposon dea1 (fragment)
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0040F08
Clone
Clone name
hba-40f8
LE_HBa0040F08
C06HBa0040F08
P040F08
Clone type
BAC
Contamination
none
Estimated length
82,041
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found