Clone Read LE_HBa0060N10_SP6_83202

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0060N10_SP6_83202
Primer
SP6
ID from Seq. Facility
LE_HBa_060_N10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
510 trimmed for vector and quality, 793 raw
Sequence
>LE_HBa0060N10_SP6_83202 (raw untrimmed)
TAATTGGGGAAGGCAAATTTTTCATTTTTGTGAAGTGAGATCTTTTAACGAAGGATAGTAACTTAAATCAACATTTTAAAGGAATTTTTTATATATTACA
GTGATATAGATGTGCTCTTGCAATTGCTTCTGGGTAATACGATGTAATACGCAAAGCAGACATAGTTCTTCTATACCCCTCATAGATAGAAAGAGGAAAC
TAGAAATGAACATTTTTTTAAAACAAAAAGAAAAGGAAGTTGGTAAATTAGTCACCAGTAACAGTTAAAAAGGTTCAGTAAACTTGTGAAAAATCAAAGG
TGTGATTGGGCAAAACACACTAACATGACAACAGACTACTTTTTTGTCACTGCTTTAGAATGGTTGGAAAACTCTCAACGTGTTGCTTTTTCTTACACGA
GGAAAAAACTATTTCTCTCTGTAGTTCTAGACGGGAATAAATCTAGTCTCTTAAAAATAGTTCTAATTAATTATTTTGTTTCATACAACTAATTCAAATT
TACAAATTTATAATTAAAATCAGAAGTACTTATTATCTAAGGATCTCCCTCTTGTCAATTATCTTGTCTTTAAATTCACTAAATTGACTATTTAAACTAC
ATTTTAATCCCTCTGACTTTTTTGAGATTTTACTAAGAAATTATTTTATATTAGTTGATAAAAAGTGACTTGAATAATGGTCAACCGTTGATATAAACCT
CCATAGTGTACAAATTAGTGTTCGGAGCTCAAATTTTCCTTTAATGGGTTCCAAATAAAAAAATTACGCACACCAATCCGTTCCGTATCATAC
>LE_HBa0060N10_SP6_83202 (trimmed for quality and cloning vector)
TTTTTGTGAAGTGAGATCTTTTAACGAAGGATAGTAACTTAAATCAACATTTTAAAGGAATTTTTTATATATTACAGTGATATAGATGTGCTCTTGCAAT
TGCTTCTGGGTAATACGATGTAATACGCAAAGCAGACATAGTTCTTCTATACCCCTCATAGATAGAAAGAGGAAACTAGAAATGAACATTTTTTTAAAAC
AAAAAGAAAAGGAAGTTGGTAAATTAGTCACCAGTAACAGTTAAAAAGGTTCAGTAAACTTGTGAAAAATCAAAGGTGTGATTGGGCAAAACACACTAAC
ATGACAACAGACTACTTTTTTGTCACTGCTTTAGAATGGTTGGAAAACTCTCAACGTGTTGCTTTTTCTTACACGAGGAAAAAACTATTTCTCTCTGTAG
TTCTAGACGGGAATAAATCTAGTCTCTTAAAAATAGTTCTAATTAATTATTTTGTTTCATACAACTAATTCAAATTTACAAATTTATAATTAAAATCAGA
AGTACTTATT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.917451
Expected error %
0.368496
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0060N10
Clone
Clone name
hba-60n10
LE_HBa0060N10
C12HBa0060N10
P060N10
Clone type
BAC
Contamination
none
Estimated length
102,109
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found