Clone Read LE_HBa0069A06_T7_83339

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0069A06_T7_83339
Primer
T7
ID from Seq. Facility
LE_HBa_069_A06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
718 trimmed for vector and quality, 885 raw
Sequence
>LE_HBa0069A06_T7_83339 (raw untrimmed)
GCTAGCCTGGCCCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGACGGAAAAGATAAATATGGTTCGTAATGTTACTCCATTGTTCATT
AACAATCAAACAGTTATGTTCCATGTCCAAAATCAAATTATCATCTATTACTCCTCCATCCTTACAAAAGCATTACTTCACAAAGTAAGATAGATGATCA
AACACCTGAACCTTTCTAAACTCACACATCCTCTTAATACCATTTTCTTAGTCCTCCTTCAACCATCATTTAAATACGAACCCCATCAAATCGAAAGAAC
ATCTTTCTAAGACAGTTTTTCCTCCTTTCATCCGTATTCGCGTCGCTTGCAGGTTAGTTTTCTGCTCCCCTCTATTTTCTTTTCTAAATAAAATAGGTAT
TGAAAGTGAAAAAATCTATTAGCTTATTTTGTGAAATAGTGGGTCCAAAGGTTTAGGGTTTAAAATAAATTATTTAATAAATATCCTTCAACTAATTAAC
TATAGTTAAAAGAATAGTTTAAGATTTGCTAATCAACTTAAATGACTATCTAAAATTACTCGGGGCATATATTGGCAAGGGTAAAATATTAATTTTATAA
AAGTTTCAAAAATGACCTTGCCAGTCATTACATTATCCACAACTAAAACCATGTCCATCCCTGAATATAAGGAAGAAGAAGGGTTATTAACCAACATGAT
CAAAAGTTCTAAGTCATGACCTACCAATCGTTGTCATCTCTCCAAGTTAGCTCCACCGTAAGACCCTTCCATCACGATCAACTACTAAAACTGAATTTTT
TGATTCCAAGTTTTGGAATATCTACAAATTAGGAGTGATTATTACGCCACAGACCTAACCCCGGAACTCAACTAAAGTGAAATCC
>LE_HBa0069A06_T7_83339 (trimmed for quality and cloning vector)
TCTAGAGTCGACCTGCAGGCATGCAAGCTTGGACGGAAAAGATAAATATGGTTCGTAATGTTACTCCATTGTTCATTAACAATCAAACAGTTATGTTCCA
TGTCCAAAATCAAATTATCATCTATTACTCCTCCATCCTTACAAAAGCATTACTTCACAAAGTAAGATAGATGATCAAACACCTGAACCTTTCTAAACTC
ACACATCCTCTTAATACCATTTTCTTAGTCCTCCTTCAACCATCATTTAAATACGAACCCCATCAAATCGAAAGAACATCTTTCTAAGACAGTTTTTCCT
CCTTTCATCCGTATTCGCGTCGCTTGCAGGTTAGTTTTCTGCTCCCCTCTATTTTCTTTTCTAAATAAAATAGGTATTGAAAGTGAAAAAATCTATTAGC
TTATTTTGTGAAATAGTGGGTCCAAAGGTTTAGGGTTTAAAATAAATTATTTAATAAATATCCTTCAACTAATTAACTATAGTTAAAAGAATAGTTTAAG
ATTTGCTAATCAACTTAAATGACTATCTAAAATTACTCGGGGCATATATTGGCAAGGGTAAAATATTAATTTTATAAAAGTTTCAAAAATGACCTTGCCA
GTCATTACATTATCCACAACTAAAACCATGTCCATCCCTGAATATAAGGAAGAAGAAGGGTTATTAACCAACATGATCAAAAGTTCTAAGTCATGACCTA
CCAATCGTTGTCATCTCT

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.938064
Expected error %
0.124885
Sequence Annotations 
Automatic Annotations
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|U12668.1:2492-2589 Score 64 E Value 2e-11 Identity 100.00% Align. Length 31bp (4.32%) Frame 2
GUS gene fusion vector pBI101.2 T-DNA region
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|U12640.1:2493-2608 Score 64 E Value 2e-11 Identity 100.00% Align. Length 31bp (4.32%) Frame 2
GUS gene fusion vector pBI101.3 T-DNA region
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0069A06
Clone
Clone name
hba-69a6
LE_HBa0069A06
P069A06
Clone type
BAC
Contamination
none
Estimated length
84,968
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found