Notice: The contact form functionality has been restored. Apologies for any inconvenience.

Clone Read LE_HBa0040F22_T7_8347

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0040F22_T7_8347
Primer
T7
ID from Seq. Facility
LE_HBa_040_F22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
801 trimmed for vector and quality, 893 raw
Genbank Accession
Sequence
>LE_HBa0040F22_T7_8347 (raw untrimmed)
GGTGGACTGTGGCCCGGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGACTTGTTTATTTATGTTGCTAATCGCAAAATTATAAGCTTGTAGA
TCGCAAAACATTTTCATTATTTTAATACAAAAAAACAGTAGTTACCGTTTTATGTCGATGAAGAACGATAAGTTCTTTTCGAATTAATGCTACTTCATCC
GTTTCATTTTATATGTCATTTGAAAAATGATGTGACTTTTCGTTCTACTCTGGTTTAATATTTTCTTAAGTTAATATTACTAATAAAAGATAACATCAAT
TAACTATTTCTGTCTTTATATATTACTCCTTCTGTTCACTTTTATTTGTCATGTTGAAACTGATTAAATTTCAAAGTTAAATTAGATTATATTAATTTTT
GAATTTCCATCGCAACTCACCACTTTTTGATAACATTTTTCCTTCGTATTTTAATCGGTATTATATATACATATCTTTTAGCAATTTCATTCTGTAATTT
TTTGATTTTTTTACGAATGGAACGGTATGAAGTCTATCGCTTGTCTCACCACAACATGTCAACGTTCGATTTGACATTATATCTCCCCACACAGTCTTCA
ACAATCAAAAACAAAATCCATGACCATCTCGTTCCACTTTGACTATGATATTAATGCAATATGACTTTGTTTTTTCTTTTCTTATCACAAGATATATTAG
CTAAAATCTATGGAATGACAAATGTACTTCCACTCGAGTGGCTGAAAACATTTGATCCATAATTGAAGCAGGGTCCAAGTAGTACAGCCATAGAGGTCCA
CTTCAAAATTAGATGAGGACACAAGTGCAACAAGCCAGAAAAAAGCTACTTTAGAGAGTGGTAATACATGCAGCGTGCGGGCTAATTAATTTG
>LE_HBa0040F22_T7_8347 (trimmed for quality and cloning vector)
AGCTTGACTTGTTTATTTATGTTGCTAATCGCAAAATTATAAGCTTGTAGATCGCAAAACATTTTCATTATTTTAATACAAAAAAACAGTAGTTACCGTT
TTATGTCGATGAAGAACGATAAGTTCTTTTCGAATTAATGCTACTTCATCCGTTTCATTTTATATGTCATTTGAAAAATGATGTGACTTTTCGTTCTACT
CTGGTTTAATATTTTCTTAAGTTAATATTACTAATAAAAGATAACATCAATTAACTATTTCTGTCTTTATATATTACTCCTTCTGTTCACTTTTATTTGT
CATGTTGAAACTGATTAAATTTCAAAGTTAAATTAGATTATATTAATTTTTGAATTTCCATCGCAACTCACCACTTTTTGATAACATTTTTCCTTCGTAT
TTTAATCGGTATTATATATACATATCTTTTAGCAATTTCATTCTGTAATTTTTTGATTTTTTTACGAATGGAACGGTATGAAGTCTATCGCTTGTCTCAC
CACAACATGTCAACGTTCGATTTGACATTATATCTCCCCACACAGTCTTCAACAATCAAAAACAAAATCCATGACCATCTCGTTCCACTTTGACTATGAT
ATTAATGCAATATGACTTTGTTTTTTCTTTTCTTATCACAAGATATATTAGCTAAAATCTATGGAATGACAAATGTACTTCCACTCGAGTGGCTGAAAAC
ATTTGATCCATAATTGAAGCAGGGTCCAAGTAGTACAGCCATAGAGGTCCACTTCAAAATTAGATGAGGACACAAGTGCAACAAGCCAGAAAAAAGCTAC
T

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.929786
Expected error %
0.493745
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0040F22
Clone
Clone name
hba-40f22
LE_HBa0040F22
C03HBa0040F22
P040F22
Clone type
BAC
Contamination
none
Estimated length
67,212
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found