Clone Read LE_HBa0069E17_SP6_83552

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0069E17_SP6_83552
Primer
SP6
ID from Seq. Facility
LE_HBa_069_E17-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
365 trimmed for vector and quality, 1370 raw
Sequence
>LE_HBa0069E17_SP6_83552 (raw untrimmed)
TAGCATGTGGGGTGGGACCAAAGGACTCTTGCGGTCGACTTGGTAGTACCTGGTCGAAATGCCAGCCAAGTTCCTCGTTGACTCGGTTGCCAAAGGAAAG
AGGCGCAAAGGAACTGTCATTGGCATGGGTATTGGCATTGGTCTTGGAACGATTTTTCTTCTTGCCCTCATGTACTTGATTGTTGTACGGGCAAGCAGTC
GAAAAGTAGTTGATCAGGAAAAGGAGCTGGATGCTTCTAACAGGGAACTGGAGGACTTGGGCTCAAGTCTGGTCATATTTTTCCATAACAAGGAGAACAC
TAAAGAGATGTGTCTTGATGACCTTTTGAAATGTACTGACAACTTTGATCAATCAAATATTGTTGGATGTGGAGGCTTCGGCTTGGTCTACAAGGCCATC
CTTCATGATGGTAGGAAAGTTGCCATCAAGCGGCTTTCATGTTACTACTGGCCAAATGGAGTCGATAATTCTCAGTCCGACGTCTAATCTCTTTCAGGAA
GCTCCGCCGTACTAATCATGGTGTCATCTTGCCAGGACTACTGTCAGTTTACATAGCTTGACCCGAGACTCTACTAGTATATCTCCACTCTGTTAGAATC
GGGTAGATGAAGCATTACAGCTCCGAGTAGTCTTTATTGTTTGTTTTTGATTCTTTATTTTATTAGTTAATATTATGATTTATTACACTTCTTCTATCCA
TTTTTCTATGTTGTTCTTTTTCTATCCCTTCTCTTTTTAATGACTTTTTTCTCTCTACTTTTGCTATATTTCTCTCTTCGTTCTGCTCTTTCTCTCTTAT
CTTCTCTCCGCCTCCTTTTTGGCCTTCTTCTTCCTTCCCCACTTTTCCCCTACTTTCCATTCGCTGTTGACGTGCCACTGGTCCTTTCCCTTACTACAAC
CTTTTATCTTAGTTTTCACATTCACGCTACCAGTCTAATTACACATTCAACATCTTAGTTTTCTAAGTTTAACTAATCTACCTTGATGATATGTAATCTA
GTCTACATTAATTACTTGCGCATCTCCTATCTTCTATTCACTATCTCTCGGACACCCTTTACGATGCAAAAGATGACTTTTCTGCGCCACCCCTGTTCTT
CTATCATGTTTTTTCCTGCTATATGCTTAACTTATGATCAGACTCTTTTTACATCTTATGTTACTCATAATCACACATTGTGTGACTCATGATCAACGCT
TACTTTGACGAACCATCAACCGTACAATATTCGATGCGTAATTTNGCGTGATCAACTTGACTTTTTTAATGCTTGTAAAACCTTGGATTTTCCTTTCATG
TTCGATTTTCCGAAAACCTTATGTGGCTNNCCCGAATTATTTCTTCAATTTTTTAAATTTTTGCTTGAAA
>LE_HBa0069E17_SP6_83552 (trimmed for quality and cloning vector)
GAAATGCCAGCCAAGTTCCTCGTTGACTCGGTTGCCAAAGGAAAGAGGCGCAAAGGAACTGTCATTGGCATGGGTATTGGCATTGGTCTTGGAACGATTT
TTCTTCTTGCCCTCATGTACTTGATTGTTGTACGGGCAAGCAGTCGAAAAGTAGTTGATCAGGAAAAGGAGCTGGATGCTTCTAACAGGGAACTGGAGGA
CTTGGGCTCAAGTCTGGTCATATTTTTCCATAACAAGGAGAACACTAAAGAGATGTGTCTTGATGACCTTTTGAAATGTACTGACAACTTTGATCAATCA
AATATTGTTGGATGTGGAGGCTTCGGCTTGGTCTACAAGGCCATCCTTCATGATGGTAGGAAAGT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.963159
Expected error %
0.373041
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g02220.1 Score 80 E Value 2e-16 Identity 18.90% Align. Length 242bp (66.30%) Frame 2
68415.m00159 leucine-rich repeat transmembrane protein kinase, putative
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g53890.1 Score 67 E Value 2e-12 Identity 14.40% Align. Length 242bp (66.30%) Frame 2
68418.m06703 leucine-rich repeat transmembrane protein kinase, putative
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
sp|Q8LPB4|PSKR_DAUCA Score 93 E Value 2e-18 Identity 18.90% Align. Length 242bp (66.30%) Frame 2
Phytosulfokine receptor precursor (Phytosulfokine LRR receptor kinase) dbj|BAC00995.1| phytosulfokine receptor [Daucus carota]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
sp|Q9ZVR7|PSKR_ARATH Score 80 E Value 2e-14 Identity 18.90% Align. Length 242bp (66.30%) Frame 2
Putative phytosulfokine receptor precursor (Phytosulfokine LRR receptor kinase) pir||D84434 probable receptor-like protein kinase [imported] - Arabidopsis thaliana ref|NP_178330.1| leucine-rich repeat transmembrane protein kinase, putative [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0069E17
Clone
Clone name
hba-69e17
LE_HBa0069E17
C01HBa0069E17
P069E17
Clone type
BAC
Contamination
none
Estimated length
136,801
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found