Clone Read LE_HBa0069E17_T7_83553

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0069E17_T7_83553
Primer
T7
ID from Seq. Facility
LE_HBa_069_E17-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
9 trimmed for vector and quality, 779 raw
Sequence
>LE_HBa0069E17_T7_83553 (raw untrimmed)
TCAAAGATCATGGTTTAAATTGTCTCTTTGGACATACTATCCCCTCATCCTAGCACCCCACCGCCCCATCAAGCGATACAGATCAATTACTTCTGCGGAA
AATATACCATTTTCTCTGTGTTTGGTCCGCTTGTTTTCTCCTGAGTTCAACTCATTTGTTGAGCAAGATTTGATACATATGTACCTAAACTAATATTTGA
CCTATATACACA
ATATAATATTTCCGCAAAGGGTGATGGTTGTATCTCCTCGTCTACCTATCTAAGAGATCTTACCTAAAAAACGAAAGCTTTTGTGTAT
TAACACTAGACAGCTCACATTTTATACTTTACACTCCCTACTGAGATAGGATTGTTAAGAATCTGCGCGCTAATTACGTAAGACTCCTGGGCAGACCTAG
CATTGTGGTTACGGATCTAACAGAGCGTAGTAACTTAAGCTCAAATCTGGTGATCGCATTAGCTACGCACTATGACCAACATCTGCAACACTACAACTGC
ACTCCCATCTCCTCCTTCTTTACATACCCTCTCATTATCCTACTACGCCTATGCGAGCGCCTTCTTCTCTGAATCGCCTTATCTGTCAGCACACACTATA
TATATTCTACGAACTCAGCATGTACTCAAAACTCCTCTTATTTAAATTTTTTTTCTTCTTATTATTATTGCTATTTGTCGTGTTCTTTCTCTTGTCTAAC
CCTTCTCGCTAACTCTACTTCCACTATACTCCAATCATATCGTGCTATGTAAAACATGTAAATATCTTTATGATTTTAT
>LE_HBa0069E17_T7_83553 (trimmed for quality and cloning vector)
ATATAATAT

This is probably not a useful sequence.

Problems:
  • Short cloning insert
  • Low complexity
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
0.419283
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0069E17
Clone
Clone name
hba-69e17
LE_HBa0069E17
C01HBa0069E17
P069E17
Clone type
BAC
Contamination
none
Estimated length
136,801
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found