Clone Read LE_HBa0069M12_T7_83927

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0069M12_T7_83927
Primer
T7
ID from Seq. Facility
LE_HBa_069_M12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
592 trimmed for vector and quality, 872 raw
Sequence
>LE_HBa0069M12_T7_83927 (raw untrimmed)
GTTAAACTCGGGACCGGGGGTACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGNTGGGCTAAAAGAAAAGGCACCCTTTAAAGCAACCAAATATGCTT
TGCCATTTCACAAAATGCCTTAAAGAAATGTGTTTTTTCGGATACTCATTAGAATTCAGTAAATTCCTCTGATCCAAATTCCCAAAAAGGGATTTTTCCA
ATTTGGGATTGATGAGTTTCAAGTACTTTGTAACACAAAATCTCGCGAATTTTGATTTTGGCTTCCTGGTAAGTAATCTGTTGGTATAACAGATTTCAAT
TCTGTTGAAAAATATATCTGATCGTTTTGACTGATGAACAGAGGAGTATGGATCGTTGTGTTAGGATCGAATTCACGCACACACTTGATAAATGAAGAAC
ACAAGAACTTTCAAGAGAAACAGATGAGAGATCTAGAGAGAGAACTTTCAAGAGAAAGAGATGAGAGATCTAGAGAGAAACCAATATTTTGTGGTAACAA
TCCGTGAGTAAATTTCCACGGCGGTGGGGTATATATATTAATAAATCAGAGTATTTTTTGTTACAGAAAACAAATGGAGAATAAATAGTACAGCCTAAAA
TTTAGGTCGGGGCGCTGCTCCGAACCCCTCCTTCGGATGGGGAGTAAACATGATTTTATCTCTTTTGTATACGAATTCCACTCCCTTATTCTCCTTATCT
CATGTTTTTCGTTCTTTTTTTATATTTTAATTTTTTCTTTTTGTATCTTTTTTTTTTTCTTTATTTTTACTATATTTTTTTATATTCTATGTTATCTTCT
CTTCCTCCGCTTTCTACAGATCAAATTAATCTCTCTTCATTAATTTCACTCATCATCGCTCCCGCAACCCAA
>LE_HBa0069M12_T7_83927 (trimmed for quality and cloning vector)
AGCTTGNTGGGCTAAAAGAAAAGGCACCCTTTAAAGCAACCAAATATGCTTTGCCATTTCACAAAATGCCTTAAAGAAATGTGTTTTTTCGGATACTCAT
TAGAATTCAGTAAATTCCTCTGATCCAAATTCCCAAAAAGGGATTTTTCCAATTTGGGATTGATGAGTTTCAAGTACTTTGTAACACAAAATCTCGCGAA
TTTTGATTTTGGCTTCCTGGTAAGTAATCTGTTGGTATAACAGATTTCAATTCTGTTGAAAAATATATCTGATCGTTTTGACTGATGAACAGAGGAGTAT
GGATCGTTGTGTTAGGATCGAATTCACGCACACACTTGATAAATGAAGAACACAAGAACTTTCAAGAGAAACAGATGAGAGATCTAGAGAGAGAACTTTC
AAGAGAAAGAGATGAGAGATCTAGAGAGAAACCAATATTTTGTGGTAACAATCCGTGAGTAAATTTCCACGGCGGTGGGGTATATATATTAATAAATCAG
AGTATTTTTTGTTACAGAAAACAAATGGAGAATAAATAGTACAGCCTAAAATTTAGGTCGGGGCGCTGCTCCGAACCCCTCCTTCGGATGGG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.965273
Expected error %
0.988157
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g14870.1 Score 64 E Value 5e-11 Identity 14.40% Align. Length 284bp (47.97%) Frame 1
68416.m01880 expressed protein contains Pfam profile PF04859: Plant protein of unknown function (DUF641
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g53380.1 Score 64 E Value 6e-11 Identity 15.40% Align. Length 284bp (47.97%) Frame 1
68414.m06051 expressed protein contains Pfam profile PF04859: Plant protein of unknown function (DUF641
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0069M12
Clone
Clone name
hba-69m12
LE_HBa0069M12
P069M12
Clone type
BAC
Contamination
none
Estimated length
123,965
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found