Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0069O12_T7_84023

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0069O12_T7_84023
Primer
T7
ID from Seq. Facility
LE_HBa_069_O12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
556 trimmed for vector and quality, 889 raw
Sequence
>LE_HBa0069O12_T7_84023 (raw untrimmed)
GTGGAGCGGGGTCCCGGGGGCTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATGCTCATTTGCTCAATACTCTCGCGCCTGAACATGGTACGACCAG
CACATTAGATACAGAAGATCCAACTGAAAGAGCAAACTTGATTCTTGAGCAAGCAGAAAAACTAGATTGCAAAAGATATGTAACTCCAAAGGACATTGTT
GAGGGCTCAGCGAACCTAAATCTTGCATTCGTTGCACAAATATTTCAACACAGGTTTGATCATCCGATAACCTGAAATTGTTCTATCTTTGAGTAACCTG
TCATAGTTGTTATTTTGTCAACATTCTCCGTCTATAAGTGAGTTTTACTCTGGTATAGGAATGGATTGACAGCAGATACCACAAAGTTGTCTTTTGCTGT
GATGATGGAGGATGATGCTCAAACTTCTCGAGAAGAAAGATGCTTTCGGTTGTGGATTAACAGTCTTGGAACTGATACTTATGTGAATAATTTATTTGAG
GACGTGAGAACCGGGTGAGTCATTTCTTGTTGCCTTCTTGATAGATGTTCTTTGGACTCTACATATGTTGCTTGTCGTTTGTATTATGCATATGGGTTCT
TTTAGAGGCACTGTGAAAAAATTTCACAAGGATTAGTTTAATGTGATACCATGCTCCATAGTCTTCAATTACGATGCCATTTCATAAGGTTGAGATACAT
TTCTCTCGCACCCGCATTTGGATAGATCTTCTTTTCCTTCTTTTTTATCGCCATTGGCAGTTGTTTTTTTTTCTGTATTATTTTTCTTTTGTGATGTTAA
AGAGAAGAAGGAGTGAATTTAGAACAAATTAAAATACTATTTTCTAATGTACTTTCTGGTACTTATAAAATAGTGCACCTACCCACCAC
>LE_HBa0069O12_T7_84023 (trimmed for quality and cloning vector)
AGCTTATGCTCATTTGCTCAATACTCTCGCGCCTGAACATGGTACGACCAGCACATTAGATACAGAAGATCCAACTGAAAGAGCAAACTTGATTCTTGAG
CAAGCAGAAAAACTAGATTGCAAAAGATATGTAACTCCAAAGGACATTGTTGAGGGCTCAGCGAACCTAAATCTTGCATTCGTTGCACAAATATTTCAAC
ACAGGTTTGATCATCCGATAACCTGAAATTGTTCTATCTTTGAGTAACCTGTCATAGTTGTTATTTTGTCAACATTCTCCGTCTATAAGTGAGTTTTACT
CTGGTATAGGAATGGATTGACAGCAGATACCACAAAGTTGTCTTTTGCTGTGATGATGGAGGATGATGCTCAAACTTCTCGAGAAGAAAGATGCTTTCGG
TTGTGGATTAACAGTCTTGGAACTGATACTTATGTGAATAATTTATTTGAGGACGTGAGAACCGGGTGAGTCATTTCTTGTTGCCTTCTTGATAGATGTT
CTTTGGACTCTACATATGTTGCTTGTCGTTTGTATTATGCATATGGGTTCTTTTAG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.963829
Expected error %
1.07298
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g35700.1 Score 179 E Value 7e-46 Identity 20.00% Align. Length 473bp (85.07%) Frame 3
68418.m04269 fimbrin-like protein, putative similar to fimbrin-like protein (ATFIM1) [Arabidopsis thaliana] GI:2905893, fimbrin [Schizosaccharomyces pombe] GI:3057144; contains Pfam profile PF00307: Calponin homology (CH) domain
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g04750.1 Score 154 E Value 2e-38 Identity 17.70% Align. Length 473bp (85.07%) Frame 3
68415.m00485 fimbrin-like protein, putative similar to fimbrin-like protein (ATFIM1) [Arabidopsis thaliana] GI:2905893; contains Pfam profile PF00307: Calponin homology (CH) domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAN13139.1| Score 179 E Value 3e-44 Identity 20.00% Align. Length 473bp (85.07%) Frame 3
putative fimbrin protein [Arabidopsis thaliana] gb|AAK76454.1| putative fimbrin protein [Arabidopsis thaliana] dbj|BAB09267.1| fimbrin [Arabidopsis thaliana] ref|NP_198420.1| fimbrin-like protein, putative [Arabidopsis thaliana] sp|Q9FKI0|FIMB2_ARATH Fimbrin-like protein 2
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_467498.1| Score 159 E Value 3e-38 Identity 18.40% Align. Length 473bp (85.07%) Frame 3
putative fimbrin [Oryza sativa (japonica cultivar-group)] dbj|BAD12911.1| putative fimbrin [Oryza sativa (japonica cultivar-group)] dbj|BAD12861.1| putative fimbrin [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0069O12
Clone
Clone name
hba-69o12
LE_HBa0069O12
P069O12
Clone type
BAC
Contamination
none
Estimated length
55,003
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found