Clone Read LE_HBa0072B24_T7_84191

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0072B24_T7_84191
Primer
T7
ID from Seq. Facility
LE_HBa_072_B24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
456 trimmed for vector and quality, 759 raw
Sequence
>LE_HBa0072B24_T7_84191 (raw untrimmed)
CCTCGTCCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATGTGTCTTTAAGATGGTTGACTTTTCGAAAATACGTGACTTCTCGCATCTT
AAGGCGAGAGAACCACTTTTTTAAGTTTAAAAAAAATATTAAAATTATAAAAGAAATATTTTTCTAAAAAGAAATTGATTAAAAACTTATTTCTTCTTCC
AAGCTTAATTGTTTTCCAATCTCCTTCCGCATCTCAGCAGTAACCTCAAAGGAGCAGCAACCATGGCGAGAATAAAAGATCATGAGTTGAGGAATAAGTC
GAAGACAGACCTTTTGGCTCAGTGAAGCATCTCACGGTAGAGCTTGCTCTTCTCCGCGTTGCAAAGGTAACCGGTGGAGCTCCTAACAAGTTATTCAAAA
TCAATGTGGTAAGGTTGTCAATTGCACAGGTTATGACTGTCATCTCACATAAACAAAAGTCAGCTCTTATATAATTTTACCACAACTACAAGAACTTGCC
TCTTACAAAAAACTTTGACCACATTTTACTGTATGGTGGCAACATCTTATTGTCTCTTTGCTTTCGCTTTTTTTTCTTTGCAACGATTAAATAATTTAAC
TATTCCTTTTATTACATTTTTAAATATATCGTAAATTACTAATCTTTTCTTTATTTTTTTCATTTAAATCATTCTCCCTTTCTTTCTTATCATTTCTTTT
TCCCTTTTTATCACTATATTTTCTTATCTTCCCTATCATCTTTATAAACTTACATTCTT
>LE_HBa0072B24_T7_84191 (trimmed for quality and cloning vector)
GAGTCGACCTGCAGGCATGCAAGCTTATGTGTCTTTAAGATGGTTGACTTTTCGAAAATACGTGACTTCTCGCATCTTAAGGCGAGAGAACCACTTTTTT
AAGTTTAAAAAAAATATTAAAATTATAAAAGAAATATTTTTCTAAAAAGAAATTGATTAAAAACTTATTTCTTCTTCCAAGCTTAATTGTTTTCCAATCT
CCTTCCGCATCTCAGCAGTAACCTCAAAGGAGCAGCAACCATGGCGAGAATAAAAGATCATGAGTTGAGGAATAAGTCGAAGACAGACCTTTTGGCTCAG
TGAAGCATCTCACGGTAGAGCTTGCTCTTCTCCGCGTTGCAAAGGTAACCGGTGGAGCTCCTAACAAGTTATTCAAAATCAATGTGGTAAGGTTGTCAAT
TGCACAGGTTATGACTGTCATCTCACATAAACAAAAGTCAGCTCTTATATAATTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.944558
Expected error %
0.815816
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g39390.1 Score 75 E Value 1e-17 Identity 78.40% Align. Length 205bp (44.96%) Frame 2
68415.m04834 60S ribosomal protein L35 (RPL35B)
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g02610.1 Score 72 E Value 2e-17 Identity 79.60% Align. Length 205bp (44.96%) Frame 2
68418.m00197 60S ribosomal protein L35 (RPL35D) ribosomal protein L35- cytosolic, Arabidopsis thaliana, PIR:T00549
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAL34210.1| Score 75 E Value 4e-16 Identity 78.40% Align. Length 205bp (44.96%) Frame 2
putative 60S ribosomal protein L35 [Arabidopsis thaliana] gb|AAK59609.1| putative 60S ribosomal protein L35 [Arabidopsis thaliana] gb|AAM61292.1| 60S ribosomal protein L35 [Arabidopsis thaliana] gb|AAC27830.1| 60S ribosomal protein L35 [Arabidopsis thaliana] ref|NP_181471.1| 60S ribosomal protein L35 (RPL35B) [Arabidopsis thaliana] pir||T00549 60S ribosomal protein L35 [imported] - Arabidopsis thaliana sp|O80626|RL352_ARATH 60S ribosomal protein L35-1
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAF34800.1| Score 74 E Value 2e-15 Identity 81.60% Align. Length 205bp (44.96%) Frame 2
60S ribosomal protein L35 [Euphorbia esula] sp|Q9M5L0|RL35_EUPES 60S ribosomal protein L35
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0072B24
Clone
Clone name
hba-72b24
LE_HBa0072B24
P072B24
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found