Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0072D12_T7_84263

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0072D12_T7_84263
Primer
T7
ID from Seq. Facility
LE_HBa_072_D12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
728 trimmed for vector and quality, 828 raw
Sequence
>LE_HBa0072D12_T7_84263 (raw untrimmed)
CTCTGATCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAAATTTGAAACATAACTTCCTTATATCATAAAGAGCAAATTTCAGTCATTA
ATTTGTCAATAGCATAATAAATTTGACAAAACAATTTAACTTCTTTTAATTTATTCAAATATGTTTGCTTAGGTATAAAATGCATAAATAATGTATATAT
AGTTTTTCTCATGACAACAACAACATAGGGTAAAAATCTTGTAAACTAGGCAAGCTCGGCTCGACTAGTTCGGTCCAGAAGACAAACTTCTAATTTTCAC
TGGCAAAGATTTCGAACTTGAGACCACCAACATAAAAATTTCAAGTTCAAATTACTTGATCACTCGAAAGGATCATATATACACACATATTGTTTCACCT
TAAACTATCTAATATTAAATATATGTATAAAAAAATATTACTTAAATCGAATCGACTGAAACAGAAATCACATAAAATTTTAACTCATTTTTAAGCCTCC
ATCTAAAAATATAGTGGACTATGTTGGGCCTTTTCTACTTATCATGCAGTCAAATAGAAAGGAATTGAAAACTACAACAGGCTCTCCAAGACAGGGTGCA
GTCTCATAGGGGAATTTGGGCCAACCTTTTAGAGATCATAATTTTGAAGTGTAACTGTTTTTTCTATAGACGTTAACTTGCATCCCTTACTCTTGAACCA
TCATTTTATAAAAAATCTTTTTCTCTAGAAAACCTACTTTAAAAAATGAAAAAATATCATTTTTTTTTTCTTTGTTTATTGACTAACTCCTATTTAATTT
CAAATACCTTAAAATAAAATAACTTTCC
>LE_HBa0072D12_T7_84263 (trimmed for quality and cloning vector)
AGCTTAAATTTGAAACATAACTTCCTTATATCATAAAGAGCAAATTTCAGTCATTAATTTGTCAATAGCATAATAAATTTGACAAAACAATTTAACTTCT
TTTAATTTATTCAAATATGTTTGCTTAGGTATAAAATGCATAAATAATGTATATATAGTTTTTCTCATGACAACAACAACATAGGGTAAAAATCTTGTAA
ACTAGGCAAGCTCGGCTCGACTAGTTCGGTCCAGAAGACAAACTTCTAATTTTCACTGGCAAAGATTTCGAACTTGAGACCACCAACATAAAAATTTCAA
GTTCAAATTACTTGATCACTCGAAAGGATCATATATACACACATATTGTTTCACCTTAAACTATCTAATATTAAATATATGTATAAAAAAATATTACTTA
AATCGAATCGACTGAAACAGAAATCACATAAAATTTTAACTCATTTTTAAGCCTCCATCTAAAAATATAGTGGACTATGTTGGGCCTTTTCTACTTATCA
TGCAGTCAAATAGAAAGGAATTGAAAACTACAACAGGCTCTCCAAGACAGGGTGCAGTCTCATAGGGGAATTTGGGCCAACCTTTTAGAGATCATAATTT
TGAAGTGTAACTGTTTTTTCTATAGACGTTAACTTGCATCCCTTACTCTTGAACCATCATTTTATAAAAAATCTTTTTCTCTAGAAAACCTACTTTAAAA
AATGAAAAAATATCATTTTTTTTTTCTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.92302
Expected error %
1.15207
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0072D12
Clone
Clone name
hba-72d12
LE_HBa0072D12
P072D12
Clone type
BAC
Contamination
none
Estimated length
97,917
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found