Clone Read LE_HBa0072G08_SP6_84398

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0072G08_SP6_84398
Primer
SP6
ID from Seq. Facility
LE_HBa_072_G08-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
720 trimmed for vector and quality, 985 raw
Sequence
>LE_HBa0072G08_SP6_84398 (raw untrimmed)
CCTTCCCGGCTAATGTGAAGACATCCCACAGCAGCCTTAGGTAACAAAAAGATATATACACAATTCCAGCTGAAAATCCTTTTGAGAAGGCATAAATGCC
CGAAATGAACCTCAACTCACCTTTCAAAAGAAGTGAAATTGATTGCTAGTAGACAATAATGTCTCCTTCATGTGGTCACATGTACTATATAATTATGAAC
CAGCACAACATATGTGGTTAAATAGTATAAGTTGAATTACCCTTTCCGTTTCAAGTAAATAGGTCGAATTGTTTCTTCACTTTTTCAAAACAATCAGGTT
AGACATATGAGTAGTTTTAAAGAATTCATTTACAAATACCACAAGAAAAAGAAAATGTTAATATGACTCCGACTGCCCCTACCATTTGCCCTCCAACTTT
AACAAACGTAATCTTGACTGAAGAAAGAAAATAATATGTCACGACTCAAGAAACTATAACTATTTGCAAAAACAGGAGAACTTACCCAAAAGAGTCATCA
AAGACGAAAGGAAGCATCCCAGCGCGGTTATTATCTGTATCGGTCCAAATGTGGCTGGTGAAACAAACAAAAAATTGTTATGTACAACTTCGATTATAGT
CCTCAAAGAAACAAGCATTATATTTTTTAAACACATACCTTCTCTTGCTGAGATAACCATTAGGTTTTCCTTCAGTGAAAGGTGAATTTGCAAATAGAGC
TGTAGCAATCTGTTTCATTGTATTAGTTAGATAACTAAATAAGTTTCATGTAGAAATAGAAAGGACAGAAAGGATAAAGGTACCTTACAGGCTGCAAGGC
AAGACCAGCACGGAACTTTCTGATCATGTCAGCTTCAAAACTGAAGTCCAAATTTACCTGTCAACAACTATTCGAAAATATTGATCACCTTATAAATGAT
GTTACCATGCGGGGCATGACGGGACCCACACCCTAATGGGGCAGAAAAAAAATAAACTTTAATGCCCCCAGGGGTTTTCCCTCCA
>LE_HBa0072G08_SP6_84398 (trimmed for quality and cloning vector)
CATCCCACAGCAGCCTTAGGTAACAAAAAGATATATACACAATTCCAGCTGAAAATCCTTTTGAGAAGGCATAAATGCCCGAAATGAACCTCAACTCACC
TTTCAAAAGAAGTGAAATTGATTGCTAGTAGACAATAATGTCTCCTTCATGTGGTCACATGTACTATATAATTATGAACCAGCACAACATATGTGGTTAA
ATAGTATAAGTTGAATTACCCTTTCCGTTTCAAGTAAATAGGTCGAATTGTTTCTTCACTTTTTCAAAACAATCAGGTTAGACATATGAGTAGTTTTAAA
GAATTCATTTACAAATACCACAAGAAAAAGAAAATGTTAATATGACTCCGACTGCCCCTACCATTTGCCCTCCAACTTTAACAAACGTAATCTTGACTGA
AGAAAGAAAATAATATGTCACGACTCAAGAAACTATAACTATTTGCAAAAACAGGAGAACTTACCCAAAAGAGTCATCAAAGACGAAAGGAAGCATCCCA
GCGCGGTTATTATCTGTATCGGTCCAAATGTGGCTGGTGAAACAAACAAAAAATTGTTATGTACAACTTCGATTATAGTCCTCAAAGAAACAAGCATTAT
ATTTTTTAAACACATACCTTCTCTTGCTGAGATAACCATTAGGTTTTCCTTCAGTGAAAGGTGAATTTGCAAATAGAGCTGTAGCAATCTGTTTCATTGT
ATTAGTTAGATAACTAAATA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.949485
Expected error %
0.213472
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23100.1 Score 79 E Value 2e-15 Identity 16.50% Align. Length 290bp (40.28%) Frame 3
68417.m03329 glutamate-cysteine ligase / gamma-glutamylcysteine synthetase (GSH1) identical to glutamate-cysteine ligase SP:P46309 from [Arabidopsis thaliana]; contains Pfam profile: PF04107 glutamate-cysteine ligase family 2(GCS2)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAB71230.1| Score 89 E Value 9e-17 Identity 18.00% Align. Length 293bp (40.69%) Frame 3
gamma-glutamylcysteine synthetase [Lycopersicon esculentum] pir||T04332 glutamate-cysteine ligase (EC 6.3.2.2) - tomato sp|O22493|GSH1_LYCES Glutamate--cysteine ligase, chloroplast precursor (Gamma-glutamylcysteine synthetase) (Gamma-ECS) (GCS)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD27390.1| Score 81 E Value 3e-14 Identity 16.70% Align. Length 293bp (40.69%) Frame 3
gamma-glutamylcysteine synthetase [Zinnia elegans]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0072G08
Clone
Clone name
hba-72g8
LE_HBa0072G08
C08HBa0072G08
P072G08
Clone type
BAC
Contamination
none
Estimated length
120,159
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found