Clone Read LE_HBa0072I07_SP6_84492

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0072I07_SP6_84492
Primer
SP6
ID from Seq. Facility
LE_HBa_072_I07-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
743 trimmed for vector and quality, 955 raw
Sequence
>LE_HBa0072I07_SP6_84492 (raw untrimmed)
CGCCATCCTTTGTGATTACATAAATTATGATTTAGACACATGGTGGACATTGAAGTAGTACTTAACCTTAACAATTAAGCCTAGAGAGATGGTTGAGTTC
TGAGCAATGGTTATAAAATGAGATAGATGGCTGTTTGTTTTATGCTTCCTGTTTTTTTTTTTTTAAAAAAATATTATGCCGAGTTTGTAAAGGAAAGATA
GTCATAAAGATATACCTACATCTCAAAATTTAGTCTCGGCCATATGAACAAATAAAGTTGGTTACTGCATTAAATCTCCTTCGTGCAGAGGCCATATGAA
CAGATAATACCTACAACTCACAGTTTAGTCCCTTAATAAATAAACATATCCTCTCTTCTTCGGTAGTCACCAACTGCGTAGCATATCTATGCAAGGCATG
AAACTTGGCCTCATAAGAAGCCACATACATACCACCTTGGTCCAAAAACATGAACTCATCCTTCTTGTGATCTCTCAAAGTCCTAGACACATATTTCTTT
AAGAACATGGCATGAAACAGAGTCCAAGTAAATGGAGGTAAAATTGAAGATTTGTGTTCCATATAAACTCTCCACCACTGCTTAGCCTCACGCTGAAGCT
GAAAAGTCATAAACTCAATCCCGTGCTAATGGAAAATTCCCAACTGATGAAGCCTCTCATTGAAATCTAAAATAAATCCATAAGCATCCTCACTCTCAGA
ACATATAAAATACAGGAGGATTCAGGTTCAAAAACTTAGTCAACATTTCATGTTGATTACCAGTCATAACATGACCCAACAAAGGATGGAAGAAACATCA
TTACCTAAATTGCCTCCATCTTGGGGACAAATAAAATAAGAGGAATGTTGGAGCTTTGATGGGGTGGAGTGAATGAATCACTTCCGGACCAACCACCCTT
TTAAGAAAGAAATAATATTTTTCCCAAACATGGGGTCAAGGGGAGAACACCTTAT
>LE_HBa0072I07_SP6_84492 (trimmed for quality and cloning vector)
AATTATGATTTAGACACATGGTGGACATTGAAGTAGTACTTAACCTTAACAATTAAGCCTAGAGAGATGGTTGAGTTCTGAGCAATGGTTATAAAATGAG
ATAGATGGCTGTTTGTTTTATGCTTCCTGTTTTTTTTTTTTTAAAAAAATATTATGCCGAGTTTGTAAAGGAAAGATAGTCATAAAGATATACCTACATC
TCAAAATTTAGTCTCGGCCATATGAACAAATAAAGTTGGTTACTGCATTAAATCTCCTTCGTGCAGAGGCCATATGAACAGATAATACCTACAACTCACA
GTTTAGTCCCTTAATAAATAAACATATCCTCTCTTCTTCGGTAGTCACCAACTGCGTAGCATATCTATGCAAGGCATGAAACTTGGCCTCATAAGAAGCC
ACATACATACCACCTTGGTCCAAAAACATGAACTCATCCTTCTTGTGATCTCTCAAAGTCCTAGACACATATTTCTTTAAGAACATGGCATGAAACAGAG
TCCAAGTAAATGGAGGTAAAATTGAAGATTTGTGTTCCATATAAACTCTCCACCACTGCTTAGCCTCACGCTGAAGCTGAAAAGTCATAAACTCAATCCC
GTGCTAATGGAAAATTCCCAACTGATGAAGCCTCTCATTGAAATCTAAAATAAATCCATAAGCATCCTCACTCTCAGAACATATAAAATACAGGAGGATT
CAGGTTCAAAAACTTAGTCAACATTTCATGTTGATTACCAGTC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.958043
Expected error %
0.40688
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38742.1| Score 120 E Value 5e-26 Identity 17.70% Align. Length 377bp (50.74%) Frame 2
hypothetical protein PGEC093P17.31 [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 119 E Value 6e-26 Identity 13.30% Align. Length 419bp (56.39%) Frame 2
putative polyprotein, 3'-partial [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0072I07
Clone
Clone name
hba-72i7
LE_HBa0072I07
P072I07
Clone type
BAC
Contamination
none
Estimated length
107,441
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found