Clone Read LE_HBa0075I11_SP6_85268

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0075I11_SP6_85268
Primer
SP6
ID from Seq. Facility
LE_HBa_075_I11-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
516 trimmed for vector and quality, 939 raw
Sequence
>LE_HBa0075I11_SP6_85268 (raw untrimmed)
AGGTTGCTTCCATTATGATGTTAAACGACGTAGTACGAGTATTCGACCATCGGGTGTCTGTCGCGACACATCTATTTTCAAGAGGCTATAGGACTATAGA
GTTTCCATTTTTTTCTACTCCTATGTTGTGCCATAGAGTAAAAGTTCATAACTACTCTTTCTTAGAATTTTCCTTGTGTTTTGTAAGAAGACGAATTCGA
GGAGTACACCACCTAGGAGAGTTAAATGGAATGAGGTGCGTGTGGGGATTCCTCCTCAAGTTGAGAAATTTCCTCAAGGTGCTAATGGTGCTCAAGTGCC
TCCCCAAGATGATAAAGTCCTTGTTCTGGCAAAAGGTTATGATGTACCGTAGTTGAGTATTAGAGATATTAGAGAAGTCTTGCTTGCTTTAGCATGATCT
AGGAATACTCAAGTGAATTTTAGTATGGTGCCTAAGGTAAATGTTATGAAGAGCACTATGACCTCTAGATTTAAAGACTTTGTGAAGCTGAATCCTCCTA
TATTTCTTATCTCGAAGGTGCGAGAGGATATCAAAGATTTCCTTGATGGTGTGTACAAGGTGTTGAGTGCTATAAGGGTTACATCTGGGAAAAAGGTGGA
GTTAGAATCTTATCAATTGACATATGTTTCCTCAATATCCATACCACTTATTAGAAGGATAATAGGGTCGGGCAATGTGTGTCTTAATTTGTTTTATGTA
CTTTAGGCTGTTAGTTGTAGGAAATAAATTATTTGGAGGAAAGAAAGTAGTACATAAATACACTCGCTCACTCTTATTACCCCCCTCTTTGATCCTCCAT
ATCTCTTTCCTTGTCCTATGCTTTAGTTTTCCTTCCCCTCGTTAACAGTCTTCTGCGTTCATGTAGTATCATCTCGTTTACCGCGAGTCGACATATCTAA
AATCTCCTTTGACTGCTTCCTATTAATTTACTTAACAAT
>LE_HBa0075I11_SP6_85268 (trimmed for quality and cloning vector)
GGTGTCTGTCGCGACACATCTATTTTCAAGAGGCTATAGGACTATAGAGTTTCCATTTTTTTCTACTCCTATGTTGTGCCATAGAGTAAAAGTTCATAAC
TACTCTTTCTTAGAATTTTCCTTGTGTTTTGTAAGAAGACGAATTCGAGGAGTACACCACCTAGGAGAGTTAAATGGAATGAGGTGCGTGTGGGGATTCC
TCCTCAAGTTGAGAAATTTCCTCAAGGTGCTAATGGTGCTCAAGTGCCTCCCCAAGATGATAAAGTCCTTGTTCTGGCAAAAGGTTATGATGTACCGTAG
TTGAGTATTAGAGATATTAGAGAAGTCTTGCTTGCTTTAGCATGATCTAGGAATACTCAAGTGAATTTTAGTATGGTGCCTAAGGTAAATGTTATGAAGA
GCACTATGACCTCTAGATTTAAAGACTTTGTGAAGCTGAATCCTCCTATATTTCTTATCTCGAAGGTGCGAGAGGATATCAAAGATTTCCTTGATGGTGT
GTACAAGGTGTTGAGT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.961471
Expected error %
0.265752
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0075I11
Clone
Clone name
hba-75i11
LE_HBa0075I11
P075I11
Clone type
BAC
Contamination
none
Estimated length
97,037
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found