Clone Read LE_HBa0075I11_T7_85269

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0075I11_T7_85269
Primer
T7
ID from Seq. Facility
LE_HBa_075_I11-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
354 trimmed for vector and quality, 780 raw
Sequence
>LE_HBa0075I11_T7_85269 (raw untrimmed)
ATTATTTCTTTGACTTGATCATCATTAAGGGGAATTCTATGGATTTTNGAACCACAAATATTCATGGTAGCAATAATTCTATTAAGTTAGACACCTAGTA
TTTAGGAGTTGATTTCTATTTCAATTTGGTTATTAGTCATAAGATTCTTGATGCTAATTTCATTGTACATTTGAAAATTTGTGTTCACAATTAGATATTC
TGTTTGCACTTATAATAGTTTTTGCTGTTTTTCACGTATATATTAGTGTAGCACATTGAAAATCATCGGTTGAATTGGACCTATACAACATATGCACTAT
ATGCCTTTGATAAAATGTCGTTAAAAATTATGTATCTAAAAATGCTACTATACAGGAAGAAAAAAATGTACAACGCTCTAATGTTACTATTGTTAGAAAA
TTATATGCACGCTGTAAGCATGCTAAAATCTTAATACTTACATGAAAAATATATAATCAAATCATTTCTCACATAACATATACAATTATGCTAGAACAGT
TAAACGTATTGATATTTAATTCATCTATTATCTCTTAAATCGCGAGTATATACTTTTCAGCAACTTCATCAGGTGACAACGCGTCTGTCTAGTGATTTCC
AAATTACACTATCTTCCAGTCACTCCACAGATACATAGCATCGGTATATCTTATATATGATGCCAATTCTATTGAACTGTATCATATCGGGGTGGCATGC
GTCTATATACTACATTTATTNATTTCAGGCTTATCTATTCACATTCCTCCCCATCGACACGTCGTATCTGCTTCTTTTTT
>LE_HBa0075I11_T7_85269 (trimmed for quality and cloning vector)
ATTTAGGAGTTGATTTCTATTTCAATTTGGTTATTAGTCATAAGATTCTTGATGCTAATTTCATTGTACATTTGAAAATTTGTGTTCACAATTAGATATT
CTGTTTGCACTTATAATAGTTTTTGCTGTTTTTCACGTATATATTAGTGTAGCACATTGAAAATCATCGGTTGAATTGGACCTATACAACATATGCACTA
TATGCCTTTGATAAAATGTCGTTAAAAATTATGTATCTAAAAATGCTACTATACAGGAAGAAAAAAATGTACAACGCTCTAATGTTACTATTGTTAGAAA
ATTATATGCACGCTGTAAGCATGCTAAAATCTTAATACTTACATGAAAAATATA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.909896
Expected error %
1.4878
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0075I11
Clone
Clone name
hba-75i11
LE_HBa0075I11
P075I11
Clone type
BAC
Contamination
none
Estimated length
97,037
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found