Clone Read LE_HBa0075O04_SP6_85542

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0075O04_SP6_85542
Primer
SP6
ID from Seq. Facility
LE_HBa_075_O04-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
750 trimmed for vector and quality, 890 raw
Sequence
>LE_HBa0075O04_SP6_85542 (raw untrimmed)
CGCGGATAATGCTTTGCTCATGATGGCATTCACACTTCAGGATGACAATGACCACATGAGACAGTAACTATTCCAGCAAAAGCATCGAGATAACGTTTTC
CATTCTCATCATACAAATATTGCATCTTCCCTTCAACAATATTTAGCTGTTTGAAATGTAAAAAGACTTATTAGCAAGAGCTTAAAATAAATCAATTAAC
AAAATGGATTAACAAACATGAACACTATTAGCCATTACTTAAGCCACTCATTCTTCTTCTTAATTTGGTTACCTATTAAATACAAGTTAATCAAGTACAA
TAAAAAAGCAGGAATATATCTCTCAAATCTCAGACTAACAAAAGAATATCAGATGTCCATCAAAGCACTGTCCTTTCAAGGTCTCTTTTTGGTGGGACAA
AGAACCCATCACCTATATTGCTTAGACACTCAAAAATTGACTCATCCGTATCAGATTCTCCAAAAATACACTACTTTTGGAGAATCCCACCCGCACCAGC
CCACATTTCTAAATCTAAGCAACTTAGAAGTCACCACCAACAACCCTTTACCATTTTTTTCCCTAATTCTATGAGATTTCTTTCCCTAGTATTTTTATCT
ATTAGGGCTCATGTTACTCTATCGAACACTAGACCACACACGTGGGTTTTCTCTCTCTAAAGTAAATAAATATCGTACCATCCAATTTGTCAACTCATAG
GATTTCAAATCTTGATTAAAAACCAAGAAAAATGTACTATAAAGTACAGAACATTTACATACACAAATTTGTACAACAACAACAAAAAAAAGAAGGATCT
TTACAGGTTTTTCGTAGAAATAGAAGAGTGAAGGACCAAAAACTTTTCTTCTTTCTCCACCCTGCATCAGCCAAGGGCCCTTAAACGGCT
>LE_HBa0075O04_SP6_85542 (trimmed for quality and cloning vector)
GATGGCATTCACACTTCAGGATGACAATGACCACATGAGACAGTAACTATTCCAGCAAAAGCATCGAGATAACGTTTTCCATTCTCATCATACAAATATT
GCATCTTCCCTTCAACAATATTTAGCTGTTTGAAATGTAAAAAGACTTATTAGCAAGAGCTTAAAATAAATCAATTAACAAAATGGATTAACAAACATGA
ACACTATTAGCCATTACTTAAGCCACTCATTCTTCTTCTTAATTTGGTTACCTATTAAATACAAGTTAATCAAGTACAATAAAAAAGCAGGAATATATCT
CTCAAATCTCAGACTAACAAAAGAATATCAGATGTCCATCAAAGCACTGTCCTTTCAAGGTCTCTTTTTGGTGGGACAAAGAACCCATCACCTATATTGC
TTAGACACTCAAAAATTGACTCATCCGTATCAGATTCTCCAAAAATACACTACTTTTGGAGAATCCCACCCGCACCAGCCCACATTTCTAAATCTAAGCA
ACTTAGAAGTCACCACCAACAACCCTTTACCATTTTTTTCCCTAATTCTATGAGATTTCTTTCCCTAGTATTTTTATCTATTAGGGCTCATGTTACTCTA
TCGAACACTAGACCACACACGTGGGTTTTCTCTCTCTAAAGTAAATAAATATCGTACCATCCAATTTGTCAACTCATAGGATTTCAAATCTTGATTAAAA
ACCAAGAAAAATGTACTATAAAGTACAGAACATTTACATACACAAATTTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.939559
Expected error %
0.0201488
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g39660.1 Score 82 E Value 3e-16 Identity 29.20% Align. Length 119bp (15.87%) Frame 1
68417.m05608 alanine--glyoxylate aminotransferase, putative / beta-alanine-pyruvate aminotransferase, putative / AGT, putative similar to SP|Q64565 Alanine--glyoxylate aminotransferase 2, mitochondrial precursor (EC 2.6.1.44) (AGT 2) (Beta-alanine-pyruvate aminotransferase) {Rattus norvegicus}; contains Pfam profile PF00202: aminotransferase, class III
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g38400.1 Score 77 E Value 1e-14 Identity 23.90% Align. Length 137bp (18.27%) Frame 1
68415.m04717 alanine--glyoxylate aminotransferase, putative / beta-alanine-pyruvate aminotransferase, putative / AGT, putative similar to SP|Q64565 Alanine--glyoxylate aminotransferase 2, mitochondrial precursor (EC 2.6.1.44) (AGT 2) (Beta-alanine-pyruvate aminotransferase) {Rattus norvegicus}; contains Pfam profile PF00202: aminotransferase, class III
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAN73303.1| Score 82 E Value 1e-14 Identity 29.20% Align. Length 119bp (15.87%) Frame 1
At4g39660/T19P19_50 [Arabidopsis thaliana] ref|NP_568064.1| alanine--glyoxylate aminotransferase, putative / beta-alanine-pyruvate aminotransferase, putative / AGT, putative [Arabidopsis thaliana] gb|AAL06923.1| AT4g39660/T19P19_50 [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD48837.1| Score 82 E Value 1e-14 Identity 29.20% Align. Length 119bp (15.87%) Frame 1
alanine:glyoxylate aminotransferase 2 homolog [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0075O04
Clone
Clone name
hba-75o4
LE_HBa0075O04
P075O04
Clone type
BAC
Contamination
none
Estimated length
56,041
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found