Clone Read LE_HBa0075O04_T7_85543

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0075O04_T7_85543
Primer
T7
ID from Seq. Facility
LE_HBa_075_O04-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
744 trimmed for vector and quality, 854 raw
Sequence
>LE_HBa0075O04_T7_85543 (raw untrimmed)
CTCAAACCGGTTCCGGGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCATATGGAGATTTGTGAGGTAGTTGTTTGTCATCTCAGCAGATTTTC
TTTCTCCTATTTATACTCTTGTTCTATTTTAGAGACAAAATCATTTGAGATTTGTGTTTTTCTTTTAAATCTATTGTAAATTGTGATACATTAGAGAGAC
TTGTGCATGATTCAACGAAGTTTAGGGGTTTAATTAAGTTGGTTGTGTTATCCGTGTTATTCTATGTTATTAAACTTTTATTCTTATTTCACTTCCGCAT
GTTATCATTACATTTGAGTTTTAGGTCGACTTGTCTAGATAGGATAAGATGAGTGTCATCAAATTTATTTTTGAATCATGATAATTGTATGCTAAATTTT
AAAGGGATCTTGAGGTAAATCATTAAATTGTTATTATATCTAGTTCTGTAATAAGAATTTATTATGTGGTTTGGCGGAAGTCTTTATCATGTCAAGTTAT
GATATATTATTATTGACAAATTTGTAGCCTAAATTAAACTAGGGCACATGTTTGTAATCTTTATGTAAAATTAAATATATTATGTTCTATTCTTTAAAAT
CGATATTATTTAATTGACATCTGAATTGACAACAACCCAACCCTTAGGTGATCCAAAGGTATTTACTACTAATTTTGAGTAATTAATACCTTCCTTACCC
AAAATTTATTTGCCCAATCTAATGAATCTAGTATTTAAGAGCTCCCAACAAGTGGATTTTGAGGGGAAAACTCCCACAACTAATTTAGGGGGAAATCCCC
ACGAAAATTAAAAACAATATGATCAAACATTTTAACTTTAATGATTTTACTGAT
>LE_HBa0075O04_T7_85543 (trimmed for quality and cloning vector)
AGCTTCATATGGAGATTTGTGAGGTAGTTGTTTGTCATCTCAGCAGATTTTCTTTCTCCTATTTATACTCTTGTTCTATTTTAGAGACAAAATCATTTGA
GATTTGTGTTTTTCTTTTAAATCTATTGTAAATTGTGATACATTAGAGAGACTTGTGCATGATTCAACGAAGTTTAGGGGTTTAATTAAGTTGGTTGTGT
TATCCGTGTTATTCTATGTTATTAAACTTTTATTCTTATTTCACTTCCGCATGTTATCATTACATTTGAGTTTTAGGTCGACTTGTCTAGATAGGATAAG
ATGAGTGTCATCAAATTTATTTTTGAATCATGATAATTGTATGCTAAATTTTAAAGGGATCTTGAGGTAAATCATTAAATTGTTATTATATCTAGTTCTG
TAATAAGAATTTATTATGTGGTTTGGCGGAAGTCTTTATCATGTCAAGTTATGATATATTATTATTGACAAATTTGTAGCCTAAATTAAACTAGGGCACA
TGTTTGTAATCTTTATGTAAAATTAAATATATTATGTTCTATTCTTTAAAATCGATATTATTTAATTGACATCTGAATTGACAACAACCCAACCCTTAGG
TGATCCAAAGGTATTTACTACTAATTTTGAGTAATTAATACCTTCCTTACCCAAAATTTATTTGCCCAATCTAATGAATCTAGTATTTAAGAGCTCCCAA
CAAGTGGATTTTGAGGGGAAAACTCCCACAACTAATTTAGGGGG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.924042
Expected error %
0.980939
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0075O04
Clone
Clone name
hba-75o4
LE_HBa0075O04
P075O04
Clone type
BAC
Contamination
none
Estimated length
56,041
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found