Clone Read LE_HBa0075P08_SP6_85598

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0075P08_SP6_85598
Primer
SP6
ID from Seq. Facility
LE_HBa_075_P08-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
700 trimmed for vector and quality, 865 raw
Sequence
>LE_HBa0075P08_SP6_85598 (raw untrimmed)
ACCCGTGGGTTTAAAAAGAACATCTCTCTTCACTAATAATAACTTTTATTTACTCACTTTTATGCACTCTATATTCTCTTATGCACGGAAAAAGTAAGAT
CATCATTATTTGTAGCCCAGACATTCTTTCTTGCCATGAATAGGAAGATTATGAAGTATTAAATTGGATAGACAAATAATCTAGAGGTTACATGAGTTTC
AAGACATAAAAATATAGAATAATGAGTGAAATAATAGAGTTCAATGAGAAGTTATGGTTAATATGGTTGACCATGTTCAATCACTAAATAAATGTCAATT
ACTCCAACGTTGTGCTAACAAAGTACGACTATCACTATTTATATGAGAGACATTTTCTCTTGCAATGAATAAGAAGAATAAGAGATAGTAAATTTGGTAG
ATAAATGACCTAGAGGTTACATGAGTTAGAACACATAGAAAGATGGAATAATGAGTGAAATAATGTGTCACAATCCAGAGTCGTGATTGACACTCACACT
AACCCTCCAATGGAAGAACCATTACTACAACCCAAACAATAACTTTTATGAAAACTAAGTATTTAAAGATACGAAAGCAAGTTTAAATGACAATAAAAAT
GAAGTACCTATAAACTCTAAGGTTTAACAAACAACTAACCAAAATAATGCGGAAGAGCAACCCCTAGAACTTGAAAGTCAATGTACCAAAACAAACTAAA
CGAGGAAACAAAGTCTAAACAAGAAGGGATACACCCCAAACTAATGAACTATTACCTAACAGAACAGATTCCTAAATGTGGACACAGACGAAAAGAGAAT
TCTGGCACCCCGAAAAATTGGTTAACCCTGATTTGCCGAGACTACTAATCTCTTAAATAGGGCTG
>LE_HBa0075P08_SP6_85598 (trimmed for quality and cloning vector)
CTCTCTTCACTAATAATAACTTTTATTTACTCACTTTTATGCACTCTATATTCTCTTATGCACGGAAAAAGTAAGATCATCATTATTTGTAGCCCAGACA
TTCTTTCTTGCCATGAATAGGAAGATTATGAAGTATTAAATTGGATAGACAAATAATCTAGAGGTTACATGAGTTTCAAGACATAAAAATATAGAATAAT
GAGTGAAATAATAGAGTTCAATGAGAAGTTATGGTTAATATGGTTGACCATGTTCAATCACTAAATAAATGTCAATTACTCCAACGTTGTGCTAACAAAG
TACGACTATCACTATTTATATGAGAGACATTTTCTCTTGCAATGAATAAGAAGAATAAGAGATAGTAAATTTGGTAGATAAATGACCTAGAGGTTACATG
AGTTAGAACACATAGAAAGATGGAATAATGAGTGAAATAATGTGTCACAATCCAGAGTCGTGATTGACACTCACACTAACCCTCCAATGGAAGAACCATT
ACTACAACCCAAACAATAACTTTTATGAAAACTAAGTATTTAAAGATACGAAAGCAAGTTTAAATGACAATAAAAATGAAGTACCTATAAACTCTAAGGT
TTAACAAACAACTAACCAAAATAATGCGGAAGAGCAACCCCTAGAACTTGAAAGTCAATGTACCAAAACAAACTAAACGAGGAAACAAAGTCTAAACAAG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.927607
Expected error %
0.473092
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0075P08
Clone
Clone name
hba-75p8
LE_HBa0075P08
P075P08
Clone type
BAC
Contamination
none
Estimated length
50,928
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found