Clone Read LE_HBa0093A11_T7_85653

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0093A11_T7_85653
Primer
T7
ID from Seq. Facility
LE_HBa_093_A11-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
764 trimmed for vector and quality, 874 raw
Sequence
>LE_HBa0093A11_T7_85653 (raw untrimmed)
CTCTACCTCGGTCCCGCGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCATCATTTTTCATCTTCATCTTCATGTCGACATCTGTGGGATATAC
CCCAAACAATATCTGGATCCCTTAACGAGTACCGAAACAAGCTCAATAATTTCTTGGGAATCTCTTCCCAATCTAAACCCTGGATCAAAACTGTTTTGGA
GCATCACAACGGCTATCATCTTGGATACGGCTGGCATGGGGGTCTGCGGGGCCAAATATTAATCAGTGGCATTCACCAGTTCCACCGTGTAAAAGGTTGT
ACCTTGTGGTATCTCATCAATAATCGGCACCTTCCTGCCCGAGTGACTCCCCTCGCCGTGAATAACAAACTCTTCATTCTTCCACACAAGCTTCATCATT
TGATAAAGAGTAGAGGGGACGACTTCAGCCATATGGATGAATGAACTTTCTAAAAGAAGGTTGTAACTGGTATCTATATCCAATACATGAAATTACGCGC
TGCACTCTTTGGGGCCCATTTGAAGGGTCAAATTCACTGCCCCCAATGTGTCTCTTTGAACCCCATCAAAAGCTCTCACGTTGACCTGGTTCTGCTCATG
TTTCCTAAGGTCAAACCTCAGCTGCCTCAATGTCGACAATGGGCAGATATTCAAACCGGATCCCTCATCCACTAAGATGCGGTTGACAACCTTTTCATTG
CATATCACGGTAATGTGCCCCGCTTTTTTTGTGTGATCTTCCTTCTACAGGCAGATCCCTGTAACTAAAGTTGATCTGGTGCCCCCCAACAACCTGATGA
ATCATGGGCCCCCCATTATCACTACTTGTCATCTAACGGTACATATCGTACCTCCAAAGCCTTTATTTAATCCT
>LE_HBa0093A11_T7_85653 (trimmed for quality and cloning vector)
AGCTTCATCATTTTTCATCTTCATCTTCATGTCGACATCTGTGGGATATACCCCAAACAATATCTGGATCCCTTAACGAGTACCGAAACAAGCTCAATAA
TTTCTTGGGAATCTCTTCCCAATCTAAACCCTGGATCAAAACTGTTTTGGAGCATCACAACGGCTATCATCTTGGATACGGCTGGCATGGGGGTCTGCGG
GGCCAAATATTAATCAGTGGCATTCACCAGTTCCACCGTGTAAAAGGTTGTACCTTGTGGTATCTCATCAATAATCGGCACCTTCCTGCCCGAGTGACTC
CCCTCGCCGTGAATAACAAACTCTTCATTCTTCCACACAAGCTTCATCATTTGATAAAGAGTAGAGGGGACGACTTCAGCCATATGGATGAATGAACTTT
CTAAAAGAAGGTTGTAACTGGTATCTATATCCAATACATGAAATTACGCGCTGCACTCTTTGGGGCCCATTTGAAGGGTCAAATTCACTGCCCCCAATGT
GTCTCTTTGAACCCCATCAAAAGCTCTCACGTTGACCTGGTTCTGCTCATGTTTCCTAAGGTCAAACCTCAGCTGCCTCAATGTCGACAATGGGCAGATA
TTCAAACCGGATCCCTCATCCACTAAGATGCGGTTGACAACCTTTTCATTGCATATCACGGTAATGTGCCCCGCTTTTTTTGTGTGATCTTCCTTCTACA
GGCAGATCCCTGTAACTAAAGTTGATCTGGTGCCCCCCAACAACCTGATGAATCATGGGCCCCC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.98201
Expected error %
1.30276
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU90285.1| Score 118 E Value 2e-25 Identity 13.10% Align. Length 626bp (81.94%) Frame 1
putative gag/pol polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAQ82035.1| Score 90 E Value 9e-19 Identity 38.40% Align. Length 429bp (56.15%) Frame 1
gag/pol polyprotein [Pisum sativum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0093A11
Clone
Clone name
hba-93a11
LE_HBa0093A11
P093A11
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found