Clone Read LE_HBa0093B17_T7_85713

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0093B17_T7_85713
Primer
T7
ID from Seq. Facility
LE_HBa_093_B17-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
679 trimmed for vector and quality, 859 raw
Sequence
>LE_HBa0093B17_T7_85713 (raw untrimmed)
CATAACTTGGTTCCCGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTCGTCATATTTCACATAGTTCAATGCTAATTTAACCTTTTGTACCCT
AGAAAAAAGGAAAGAAAAAAACCAAACCTAATAATCCAACTTATGCATAGTTGATCTCAAATTATGTGCAAAATGATTCTGCTATGCTCTATATTACTAG
TTAGGGTCAAATTTATTAGGGAAAATATATCAAATTTTCTTTGAACTTGGCATGAAAATTCGCTTTAGTACTTAAATTATACGCACGTTTAAATCATCCC
CTTATCATCTTTGAAGTGATTTAAACACCCCCTTAGGGATGACGAGGCAGGAAGAGTGGGTGTACTCTCCTTAAAGCGCATGAAAGAAGAAAAAAGAATT
TAGAATTTTTTGAAATTCTACACTTAGCCTTTTTTTATTGGTCAATATATAATTAATATTTTAAATGCTTTTTCTTGATATATTAACTCTCTAAAAATAT
AGAATTAGTGGATCCCTTTTTAATTTCTTTATTTTTTTTCTTTTCATTTTGTTGTCTTCCCCAATACACTTTTTTTCTCCTCCATATTCCTCCCACTTAA
AAAAAACTATTTTTATTTTATTAATCCTTTACTAATTCGTAAAATTCAATATCAAAGTTATTTTATTCACGTTGATTTCGCTCTATATTATTGGTGTCGA
TTTTGTCAATGTAAACTCTCTTAATTTTGACTGACCCTTTTTGACTTCCAGACCCTATTCAATATTTTCTCATAGAATTTAAATTCTTTTATCACCTAAC
TTATGAAACCCTCATTACCTATTTTGAATTTAAAATAAAACCTAGGCTTCTAAAAAAAA
>LE_HBa0093B17_T7_85713 (trimmed for quality and cloning vector)
AGCTTTCGTCATATTTCACATAGTTCAATGCTAATTTAACCTTTTGTACCCTAGAAAAAAGGAAAGAAAAAAACCAAACCTAATAATCCAACTTATGCAT
AGTTGATCTCAAATTATGTGCAAAATGATTCTGCTATGCTCTATATTACTAGTTAGGGTCAAATTTATTAGGGAAAATATATCAAATTTTCTTTGAACTT
GGCATGAAAATTCGCTTTAGTACTTAAATTATACGCACGTTTAAATCATCCCCTTATCATCTTTGAAGTGATTTAAACACCCCCTTAGGGATGACGAGGC
AGGAAGAGTGGGTGTACTCTCCTTAAAGCGCATGAAAGAAGAAAAAAGAATTTAGAATTTTTTGAAATTCTACACTTAGCCTTTTTTTATTGGTCAATAT
ATAATTAATATTTTAAATGCTTTTTCTTGATATATTAACTCTCTAAAAATATAGAATTAGTGGATCCCTTTTTAATTTCTTTATTTTTTTTCTTTTCATT
TTGTTGTCTTCCCCAATACACTTTTTTTCTCCTCCATATTCCTCCCACTTAAAAAAAACTATTTTTATTTTATTAATCCTTTACTAATTCGTAAAATTCA
ATATCAAAGTTATTTTATTCACGTTGATTTCGCTCTATATTATTGGTGTCGATTTTGTCAATGTAAACTCTCTTAATTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.909905
Expected error %
0.607346
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0093B17
Clone
Clone name
hba-93b17
LE_HBa0093B17
C12HBa0093B17
P093B17
Clone type
BAC
Contamination
none
Estimated length
96,200
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found