Clone Read LE_HBa0093H06_T7_85979

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0093H06_T7_85979
Primer
T7
ID from Seq. Facility
LE_HBa_093_H06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
472 trimmed for vector and quality, 878 raw
Sequence
>LE_HBa0093H06_T7_85979 (raw untrimmed)
TTAGCCTGGGCCCGCGGGATCCTTCTAGAGTCGACCTGCAGGCATGCAAGCTTCCCCTTCTTACAAAATCTCACCTTTCTCTTAATGAGTGAAAATTTAA
AGTATTCCTAATATTCCTGTAATATTTCTGACGACTCTGTCGGTTTTTCAACCTCTCTTGAATCACCTTCGCCTTATCCTTAGCTTGATGAACTGAATTC
GGTCCTATGAACATAGCTTCACATACTTCAAACCATCCAATAGGAGATCTGCATTTTCTCCCATAAAGAGCTTCACAAGGATCAATTTGCATGCTACAGT
GGTAATTATTCAATAAAAGGAAGGCGATCCTACCAATTACCATTGAAATAAATCACACAAACTCTTAACATATCATATAAGGTATGAATAGTACACTCTA
CTTTCCCATAGGTTTGAAGATTAAGGCAGTACTTAAGTTCACCTTTGAACCCAAGTCTTTAGGGATGACTTCCAAAAAACTCATCAGATTGCTTATAAAC
ATTTTCCTCTAAATCCAAGAAAAATAGGGACTTGCTCTTGCGTCTATTATACTTTTAACACTAATGATGATTCAACCCCTATGCGTCACTCACTCCTCCT
CCTTCTTTGGATTCCCTTACACCTTCTCTTAGGTGTGCTCCTCTACGCTCATCTCTCTCTTATCTTTTCCTTCTTCATCCACTTGCGGTGTAGTTTTCTT
TAGTGCACTTTCTTCTAGGCCTATTAAACTCTTTTTCCTCAACTTTGGCTAATTCTCCATATCTCTCACCCTCTTAGCTATTTTATTTTTGCCCTTGTTC
TCCTTTTCTTCTCTCCCTACCATCCCTCGCTCATCGTCCTCTCTCTTTATTCTCTTCTTCCCATCACCTTTTTCTTTG
>LE_HBa0093H06_T7_85979 (trimmed for quality and cloning vector)
CTAGAGTCGACCTGCAGGCATGCAAGCTTCCCCTTCTTACAAAATCTCACCTTTCTCTTAATGAGTGAAAATTTAAAGTATTCCTAATATTCCTGTAATA
TTTCTGACGACTCTGTCGGTTTTTCAACCTCTCTTGAATCACCTTCGCCTTATCCTTAGCTTGATGAACTGAATTCGGTCCTATGAACATAGCTTCACAT
ACTTCAAACCATCCAATAGGAGATCTGCATTTTCTCCCATAAAGAGCTTCACAAGGATCAATTTGCATGCTACAGTGGTAATTATTCAATAAAAGGAAGG
CGATCCTACCAATTACCATTGAAATAAATCACACAAACTCTTAACATATCATATAAGGTATGAATAGTACACTCTACTTTCCCATAGGTTTGAAGATTAA
GGCAGTACTTAAGTTCACCTTTGAACCCAAGTCTTTAGGGATGACTTCCAAAAAACTCATCAGATTGCTTAT

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.951
Expected error %
0.657784
Sequence Annotations 
Automatic Annotations
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|X65303.1:1-108 Score 62 E Value 5e-11 Identity 100.00% Align. Length 30bp (6.36%) Frame 2
Cloning vector pGEM-4
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38724.1| Score 104 E Value 1e-22 Identity 52.40% Align. Length 433bp (91.74%) Frame 1
putative retrotransposon protein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38744.1| Score 104 E Value 1e-22 Identity 52.40% Align. Length 433bp (91.74%) Frame 1
putative gag-pol polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0093H06
Clone
Clone name
hba-93h6
LE_HBa0093H06
P093H06
Clone type
BAC
Contamination
none
Estimated length
91,874
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found