Clone Read LE_HBa0093P04_SP6_86358

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0093P04_SP6_86358
Primer
SP6
ID from Seq. Facility
LE_HBa_093_P04-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
512 trimmed for vector and quality, 876 raw
Sequence
>LE_HBa0093P04_SP6_86358 (raw untrimmed)
GCCAGCTTTTTGCCAGGTTCTCTAAGTGTGAGTTTTGGCTAGATGCAGTGTCCTTCTTGGGGCACGTGGTTTCTCATTGAAGGAGTGATGGTGGATCCTT
CTAAGGTTGAGACGGTGAAGAATTGGGTAAGACCCACTAACGTGTCAGAAATAAGGAGCTTTGTTGGATTAGCTAGCTACTACCGCCGATTTGTCAAGGG
ATTCTCTTCTATTTCTTCCCAATTGACGAACTTGACTAAGCAGAATGTTCCATTTGTATGGTCGGACGAATGTGAGGAAAGCTTTCAGAAGCTCAAGACT
TTGTTGACTACCGCACCTATCCTTACCTTGCCAGTAGAGGGTAAGAACTTCATTGTTTATTGTGATGCATCCTATTCTGGTTTGGGTGCAGTACTAATGC
AAGAGAAGAGTGTGATTGCTTATGCTTCAAGGCAACTAAAGGTGCATGAACGTAACTATCCGACCCATGATTTGGAATTGGCTGCGGTGGTGTTTGCATT
AAAGCAATGCAGACACTATTTATATGGGGTTAAGTGTGAGATCTTTACGGATCAGAGTAGTCCACAGTATGTCTTTACACATAAAGAGTTTGAACTTGAG
ACGCAGCAGATGGATGAAATCACTGAAGGCTTCTCACTCCGCTCTCTTCTATCATCCGCGGAATGCTATTCTTTATTCCGACGTTTTTATATATAAGTTG
TAATCGTGTATCTACCTGTCCCGTGCCAGATCTCCAACTCACCATGCGTCAAAGTCTCTCTTCCCCGCCTTCTTCGTTTGCCTCTTCCACCGAGCGTACT
CCGCTTCTCTTGGGCGTAGTTGTTTTTTTCATCTTTCCTGCATTCCTCGTTATCATATGTGACTTCCTACACCGTA
>LE_HBa0093P04_SP6_86358 (trimmed for quality and cloning vector)
TCTCTAAGTGTGAGTTTTGGCTAGATGCAGTGTCCTTCTTGGGGCACGTGGTTTCTCATTGAAGGAGTGATGGTGGATCCTTCTAAGGTTGAGACGGTGA
AGAATTGGGTAAGACCCACTAACGTGTCAGAAATAAGGAGCTTTGTTGGATTAGCTAGCTACTACCGCCGATTTGTCAAGGGATTCTCTTCTATTTCTTC
CCAATTGACGAACTTGACTAAGCAGAATGTTCCATTTGTATGGTCGGACGAATGTGAGGAAAGCTTTCAGAAGCTCAAGACTTTGTTGACTACCGCACCT
ATCCTTACCTTGCCAGTAGAGGGTAAGAACTTCATTGTTTATTGTGATGCATCCTATTCTGGTTTGGGTGCAGTACTAATGCAAGAGAAGAGTGTGATTG
CTTATGCTTCAAGGCAACTAAAGGTGCATGAACGTAACTATCCGACCCATGATTTGGAATTGGCTGCGGTGGTGTTTGCATTAAAGCAATGCAGACACTA
TTTATATGGGGT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.978722
Expected error %
0.372464
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 205 E Value 4e-57 Identity 65.30% Align. Length 507bp (99.02%) Frame 1
putative polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 204 E Value 6e-57 Identity 66.00% Align. Length 507bp (99.02%) Frame 1
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0093P04
Clone
Clone name
hba-93p4
LE_HBa0093P04
C08HBa0093P04
P093P04
Clone type
BAC
Contamination
none
Estimated length
135,262
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found