Clone Read LE_HBa0093P12_SP6_86374

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0093P12_SP6_86374
Primer
SP6
ID from Seq. Facility
LE_HBa_093_P12-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
699 trimmed for vector and quality, 919 raw
Sequence
>LE_HBa0093P12_SP6_86374 (raw untrimmed)
GCGAGAATTTTGCCTCTGCAGTATCATCCATTAACTTTGTGAACTCCTCTAGATTGATCTCACCTTGTATTGCTTCGTTTGCATTATTCCCAGTTTTCAA
ACTCTCAAAGACAGCCTTTTGCTTGCTTGTCAGTTCAATATCTGCCAACTAAAAGAATTTGCAAATAGAATCAGAAAACAATTTAAATGCTTAAGAGAAA
TAAGGAAATTTAGCATGGTAGCATATGCTTAAGAGAAATAAGGAAATTTAGCATGGTAGCATAAGTATGGAACTGAATTAAGAAGAATTACTTACTTGCT
GCTCAACATTTATGAGCCAAACATCAACTTGCTTTAATAGTTCTTCTTGCACTTTCTTCTTTTTCAATGCTAAAAGGGCCCTCTCTTTCTTCTTTTCGCG
TAGCAAGTCTTTTGCAGCTTGTTTTTCGGCTTCAATAACAGCATCCAGCTGAAACAAAGAATAACAGAAGGGATTAGCAGGTCTGAAACCAACATTGAGG
AAAGCTTGCAAATCAGTCCTACGTGGAGCCCTTGGCACCAAAAAAAGAGGAGAGGACCTTTAAGTTCTTATTGTGGACAATCTCAGTTGCACCGTTTAAT
AGAATTCCAAAAAACTTCCCCTACTTCATGTAAAACCAACTTCTACCCAATTTTGGGTTTTTCTTTCTTTTTATTACTTTTCAATTTTGTTGGGATTGTT
AGCATTCTGACTAACTGCATAATCAAGGTATGGGTCACTCTCCTGTAGAACTTCCCCGAACTATTAAAATAAGCTGGGTGGCCCAGTGCAATGAAACGAA
AATGCCCCTTCTTTTTTTTTTTGGGTCTTTTTAACAGAAAATTGAAATTAACCACCAAGGGGTATGTATTTCAGTAATGGTTGATTGGTGAAACTGGAGT
CTTGGTATAAAGGAAATTA
>LE_HBa0093P12_SP6_86374 (trimmed for quality and cloning vector)
TATCATCCATTAACTTTGTGAACTCCTCTAGATTGATCTCACCTTGTATTGCTTCGTTTGCATTATTCCCAGTTTTCAAACTCTCAAAGACAGCCTTTTG
CTTGCTTGTCAGTTCAATATCTGCCAACTAAAAGAATTTGCAAATAGAATCAGAAAACAATTTAAATGCTTAAGAGAAATAAGGAAATTTAGCATGGTAG
CATATGCTTAAGAGAAATAAGGAAATTTAGCATGGTAGCATAAGTATGGAACTGAATTAAGAAGAATTACTTACTTGCTGCTCAACATTTATGAGCCAAA
CATCAACTTGCTTTAATAGTTCTTCTTGCACTTTCTTCTTTTTCAATGCTAAAAGGGCCCTCTCTTTCTTCTTTTCGCGTAGCAAGTCTTTTGCAGCTTG
TTTTTCGGCTTCAATAACAGCATCCAGCTGAAACAAAGAATAACAGAAGGGATTAGCAGGTCTGAAACCAACATTGAGGAAAGCTTGCAAATCAGTCCTA
CGTGGAGCCCTTGGCACCAAAAAAAGAGGAGAGGACCTTTAAGTTCTTATTGTGGACAATCTCAGTTGCACCGTTTAATAGAATTCCAAAAAACTTCCCC
TACTTCATGTAAAACCAACTTCTACCCAATTTTGGGTTTTTCTTTCTTTTTATTACTTTTCAATTTTGTTGGGATTGTTAGCATTCTGACTAACTGCAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.945335
Expected error %
0.36794
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g09260.1 Score 75 E Value 3e-14 Identity 12.80% Align. Length 428bp (61.23%) Frame 3
68418.m01069 SNF7-related contains similarity to nuclear protein SNF7 [Saccharomyces cerevisiae] SWISS-PROT:P39929
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0093P12
Clone
Clone name
hba-93p12
LE_HBa0093P12
C12HBa0093P12
P093P12
Clone type
BAC
Contamination
none
Estimated length
46,777
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found