Clone Read LE_HBa0093P12_T7_86375

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0093P12_T7_86375
Primer
T7
ID from Seq. Facility
LE_HBa_093_P12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
775 trimmed for vector and quality, 869 raw
Sequence
>LE_HBa0093P12_T7_86375 (raw untrimmed)
ACTTAACTCGGGTCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCATTCCTGAAAATACACAACACTGTACTAAAATACTTCTAAATCAC
TATGAGCTTATGGAAACCCGGAAAAATCAGTTAACATTCAGCAGCTTAACAAGACCAAAACTAAAGAGGAAAATGTTGTACGTTATTACACTCATTTGAG
CTATTTCAAGAGGATACAATAAGAGAAGGGTAAATTCTGCTTGAACTCGTTGCTTTCAACTCGAACCACATAAGCCATTGGAAAATGCTATGGTTAGGTC
CATCCATAAGAGGTGCTAAGTAGACCATTAACTTGTCCTCCTCCTATACATATAAATACATCACTATAGGTATTGGAAAAAACAGATGTTTTTCCACCAT
AGTATGATGAAAAAAAACGGAGCTCATCCGTCTTGTGAGACTTTCCAACGACTAGTAACTCAAATCGTAGTTGCTACAAATCGATTCTTCCTACTTCCCT
TCTTGTACTTGTCCCTTACACGAAACATAGATTTTAGCTAATCAAGAGAAATTAAGCAACTACATAATGTATTAGCTATCACTTAACTACATAAGGAACA
AGTAAAAAAGAAATGTCTATGCATAACAAGATCATGCTAAAATACTAAGTTCTTGAACAAACAAAGTTATCTCTGTGTGACCTATACGTTTAATTAGTAC
TATTTATATCGAGATGCTTTGTACACTGAACTGAGACAATGGAAACACAAACATATATAGTATGTTCTTTTTACCTATGTGGACATCTATCTTCCAAACC
TCCAAGTTCACCACTTCCATCTTTATACAAACCACCTGTTTATCAAAGACAGTAAAACCTAAAGGTGCT
>LE_HBa0093P12_T7_86375 (trimmed for quality and cloning vector)
AGCTTCATTCCTGAAAATACACAACACTGTACTAAAATACTTCTAAATCACTATGAGCTTATGGAAACCCGGAAAAATCAGTTAACATTCAGCAGCTTAA
CAAGACCAAAACTAAAGAGGAAAATGTTGTACGTTATTACACTCATTTGAGCTATTTCAAGAGGATACAATAAGAGAAGGGTAAATTCTGCTTGAACTCG
TTGCTTTCAACTCGAACCACATAAGCCATTGGAAAATGCTATGGTTAGGTCCATCCATAAGAGGTGCTAAGTAGACCATTAACTTGTCCTCCTCCTATAC
ATATAAATACATCACTATAGGTATTGGAAAAAACAGATGTTTTTCCACCATAGTATGATGAAAAAAAACGGAGCTCATCCGTCTTGTGAGACTTTCCAAC
GACTAGTAACTCAAATCGTAGTTGCTACAAATCGATTCTTCCTACTTCCCTTCTTGTACTTGTCCCTTACACGAAACATAGATTTTAGCTAATCAAGAGA
AATTAAGCAACTACATAATGTATTAGCTATCACTTAACTACATAAGGAACAAGTAAAAAAGAAATGTCTATGCATAACAAGATCATGCTAAAATACTAAG
TTCTTGAACAAACAAAGTTATCTCTGTGTGACCTATACGTTTAATTAGTACTATTTATATCGAGATGCTTTGTACACTGAACTGAGACAATGGAAACACA
AACATATATAGTATGTTCTTTTTACCTATGTGGACATCTATCTTCCAAACCTCCAAGTTCACCACTTCCATCTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.951285
Expected error %
0.571742
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0093P12
Clone
Clone name
hba-93p12
LE_HBa0093P12
C12HBa0093P12
P093P12
Clone type
BAC
Contamination
none
Estimated length
46,777
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found