Clone Read LE_HBa0102E23_T7_86637

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0102E23_T7_86637
Primer
T7
ID from Seq. Facility
LE_HBa_102_E23-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
199 trimmed for vector and quality, 834 raw
Sequence
>LE_HBa0102E23_T7_86637 (raw untrimmed)
CCAGTACGCCCCTCGTTCCAGGGGGGACCTCTACAGTCGACCTGCAGGCATGCAAGCTTGAACTGCCCTCTTAAAGTACCCCTTTGGCTTGATCTTTTCC
CTGATGAAGTTGCCATAGGAGCCCGTCAGACTGTGAAACAGTTTCTCCATCAGTAGGATAAGCTAGTATTGCATGTGAGTAACATTCGGCGCCACCTAGG
AGGTCTCCCTCAGACTGCCAGTCCATCACCCAACG
TGAGAAATGTCAGAATTAGCAAGACCAGGCGATATTATTAATATGTAAGCACCAATGAAGGGAGA
TAGCTTTTCTTGTTTTTGGTTACGTTCTGACAAGTAAACGATAAACTGCTGTAGCTATTGTAAAGATCTGGTGAAAGGAATGACATAATGTTCAAGAAAA
TTTCATATATGAGCATGCATTTATATTTCTCCATCCCAATCCTCCTGAATTATGATGACCTGCTGTTCTTTTGTATCTTTTTTTGAATTGGCCCACATTT
TAATAATGCATATTCGGGTCGAAGCATGAGTAATCTCTTACACTTTATGAGAATGACTTGTGTCATTTTAGCATTTTTCGGACTATTATTACTTTTTTTA
GTTTACGATATATTAGAGAATGTACTGATGGGTATTTTCGCTTCAAATATCTTTCGTTTTTTGTTCTGATTTCTTTTGAAGTTCTCATTGCCTGACTTAT
TTCTTTTTTTTTTCTCATCGCTTAAATATTGTAGATTTAATTTTTTTCTGTCTTTTTTCCGTCTTATCTTCATTTCTTATATTTTTTTTTTGTTTGTTTG
TCTCTTATGGTTTTAGTTTGTTGTGGTTATGGTT
>LE_HBa0102E23_T7_86637 (trimmed for quality and cloning vector)
TGAGAAATGTCAGAATTAGCAAGACCAGGCGATATTATTAATATGTAAGCACCAATGAAGGGAGATAGCTTTTCTTGTTTTTGGTTACGTTCTGACAAGT
AAACGATAAACTGCTGTAGCTATTGTAAAGATCTGGTGAAAGGAATGACATAATGTTCAAGAAAATTTCATATATGAGCATGCATTTATATTTCTCCAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.934895
Expected error %
1.85674
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0102E23
Clone
Clone name
hba-102e23
LE_HBa0102E23
C09HBa0102E23
P102E23
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found