Clone Read LE_HBa0102I04_T7_86791

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0102I04_T7_86791
Primer
T7
ID from Seq. Facility
LE_HBa_102_I04-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
775 trimmed for vector and quality, 820 raw
Genbank Accession
Sequence
>LE_HBa0102I04_T7_86791 (raw untrimmed)
AACCCGGGACCGGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTGTTGTAAGAAAGAAAAACGAAAATCAATTTAAGTTGATCACTAATTAAATT
TTTCATTCCCTTTAAAGCAATTCTTGATCTTCTCAAAAAAAATTGTAATACATCAATTTTTCGCCAAGTTGATCACCAACTAAACTTACATTCTCATTTC
AAAGCTATTCTTGATCTTTTCAGAATTTTTATGTATATTTATCTTTCATATTCATTTTTTTTATTGTATTTAACGTCTATAGGCTTTGTAAGAAAGAAAA
AAAAAACAAAAACCAATTCAAGTTGATCACTAATTAAATTTTTCATTCCCTTTAAAGCAATTCTTGATCTTCTCAAAAAAAATTGTAATACATCAATTTT
TCGCCAAGTTGATCACCAACTAAACTTACATTCTCATTTCAAAGCTATTCTTGATCTTTTCAGAATTTTTACGTATATTTATCTTTCACCTTGTATCCTA
ACACTTCTATAATCTTATATAAGAAAAAAACAACGATAATCAATTCAAGTTGGTCACCAACTAAACTTTTCATTTCTATTTCAAAGCAATTCTTGATCTT
TTTAGAATTTTTACATACATACATCTTTCACCATATACCCCAACACTCTTATAATTTTATATAAGAAAAAAAACACGATAACCAATTCAAGTAGGTAACA
AGCTAAACTTTTCATTCCCATTCAAAGCAATTTTTTTTTAATCTTTTTAGAATTTTTACGTTACATTCCTCTTTCACTTAGTATCCGAAACTCCTATAAT
CTTATGTAAGGAAAAAAAAA
>LE_HBa0102I04_T7_86791 (trimmed for quality and cloning vector)
AGCTGTTGTAAGAAAGAAAAACGAAAATCAATTTAAGTTGATCACTAATTAAATTTTTCATTCCCTTTAAAGCAATTCTTGATCTTCTCAAAAAAAATTG
TAATACATCAATTTTTCGCCAAGTTGATCACCAACTAAACTTACATTCTCATTTCAAAGCTATTCTTGATCTTTTCAGAATTTTTATGTATATTTATCTT
TCATATTCATTTTTTTTATTGTATTTAACGTCTATAGGCTTTGTAAGAAAGAAAAAAAAAACAAAAACCAATTCAAGTTGATCACTAATTAAATTTTTCA
TTCCCTTTAAAGCAATTCTTGATCTTCTCAAAAAAAATTGTAATACATCAATTTTTCGCCAAGTTGATCACCAACTAAACTTACATTCTCATTTCAAAGC
TATTCTTGATCTTTTCAGAATTTTTACGTATATTTATCTTTCACCTTGTATCCTAACACTTCTATAATCTTATATAAGAAAAAAACAACGATAATCAATT
CAAGTTGGTCACCAACTAAACTTTTCATTTCTATTTCAAAGCAATTCTTGATCTTTTTAGAATTTTTACATACATACATCTTTCACCATATACCCCAACA
CTCTTATAATTTTATATAAGAAAAAAAACACGATAACCAATTCAAGTAGGTAACAAGCTAAACTTTTCATTCCCATTCAAAGCAATTTTTTTTTAATCTT
TTTAGAATTTTTACGTTACATTCCTCTTTCACTTAGTATCCGAAACTCCTATAATCTTATGTAAGGAAAAAAAAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.885062
Expected error %
0.832271
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0102I04
Clone
Clone name
hba-102i4
LE_HBa0102I04
C12HBa0102I04
P102I04
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found