Clone Read LE_HBa0102L15_T7_86957

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0102L15_T7_86957
Primer
T7
ID from Seq. Facility
LE_HBa_102_L15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
699 trimmed for vector and quality, 847 raw
Genbank Accession
Sequence
>LE_HBa0102L15_T7_86957 (raw untrimmed)
TCCGGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTGTTTCCTCTTTGTTCGTACCTTTTTCGATCGTTTCTCTTTCCCTCTCCT
TGTTTTTTCAATTTTTCTTATTCAAACCCTCTTTCTTTTACCCTAATTAGCATATAATTAAGTATAAAAGATGAGGAATTAACTCAAGGTTATCTCCTTT
AACCCTCAAGTAATTGAGTTATTAATATTAAACCACTAACTTTATAATTATAAGCAGGAATAGTCCAAAACACCTCTTAAAATATTTACAGAAATCCGAC
CCAGCCTGGGATTACGCAACCTGTGACGGGCCGTCGTGCCTGCGACGGTCCGTCCTGCTGAGTCGTCACAGAGTTCAGAGAATCACTTTTTATTTAAGAC
CCTGTGACGACCCGTCATGCCTGTGACGGTCCATCCTGCCACTTCGTCACGAAGTTCAGAGAGTCGATTTCAGTACCCAAATTTCAGAATTCTAAGTGTT
TTGGAACGAGACCCCCTCGACGGTCCGTCGTGCCCATGACGATCCGTCGTGGGATCCGTCGACCAAGACAGTTTTTCCAGAAATGAAGTCTGCTGCTCAA
AACGACTAAACAGGTCATTACAATAGATACCAATTTACCCATCATTCGTCCTCGAATGATCATAAGAAGAAAAACAAGTTACTAAAAGGAGTACCTGAAT
CTTTAAACAGGTGTGGGTATCTTTCTTGCATTTCTGCCTCTTTCCCCCTAGTGGCTTCCTCAACTGGGTCAATTCTTTCATGAAATTTTGATGGGAGTCT
ATCTCCCCTTGACCTCATGTTGGGGAATTTTCCTTATTTAAAAAAAC
>LE_HBa0102L15_T7_86957 (trimmed for quality and cloning vector)
AGCTTGTGTTTCCTCTTTGTTCGTACCTTTTTCGATCGTTTCTCTTTCCCTCTCCTTGTTTTTTCAATTTTTCTTATTCAAACCCTCTTTCTTTTACCCT
AATTAGCATATAATTAAGTATAAAAGATGAGGAATTAACTCAAGGTTATCTCCTTTAACCCTCAAGTAATTGAGTTATTAATATTAAACCACTAACTTTA
TAATTATAAGCAGGAATAGTCCAAAACACCTCTTAAAATATTTACAGAAATCCGACCCAGCCTGGGATTACGCAACCTGTGACGGGCCGTCGTGCCTGCG
ACGGTCCGTCCTGCTGAGTCGTCACAGAGTTCAGAGAATCACTTTTTATTTAAGACCCTGTGACGACCCGTCATGCCTGTGACGGTCCATCCTGCCACTT
CGTCACGAAGTTCAGAGAGTCGATTTCAGTACCCAAATTTCAGAATTCTAAGTGTTTTGGAACGAGACCCCCTCGACGGTCCGTCGTGCCCATGACGATC
CGTCGTGGGATCCGTCGACCAAGACAGTTTTTCCAGAAATGAAGTCTGCTGCTCAAAACGACTAAACAGGTCATTACAATAGATACCAATTTACCCATCA
TTCGTCCTCGAATGATCATAAGAAGAAAAACAAGTTACTAAAAGGAGTACCTGAATCTTTAAACAGGTGTGGGTATCTTTCTTGCATTTCTGCCTCTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.972231
Expected error %
0.885654
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0102L15
Clone
Clone name
hba-102l15
LE_HBa0102L15
C10HBa0102L15
P102L15
Clone type
BAC
Contamination
none
Estimated length
184,275
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found