Clone Read LE_HBa0102L21_SP6_86968

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0102L21_SP6_86968
Primer
SP6
ID from Seq. Facility
LE_HBa_102_L21-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
92 trimmed for vector and quality, 771 raw
Sequence
>LE_HBa0102L21_SP6_86968 (raw untrimmed)
TTGACGGTTGCACTTACTTGACGCCGCAAACATGGAAATAATTTGCTGGAGTTGTTACATTCACCACCTCCCATATAGGTTCCTGAATCTGCTTCCTTAG
CGTAGGTTCCATCCTCAGGAGAACAAACGGGNNGNCANCACNCANCNGNCANGGAAAAGNANCNCANNAAANNGAGCAAAANACAAAGGCGAAAAACANN
GNNGAAACAANCAGAGAACACAACNCAGAAACCGAAAGNAGAAGAAACAGGACNCNAAAGGAAGAAGGGGCANNACAAGACCCNNNAGGAAACNGNNNGA
AGNANNCAGNACANGAANNGGACANNANANNANAAACNCNNGNANCGNGNGANNAAACCAGACCCANANCAANANNNACNNCACNGNACAACANAANNNG
GACCNNANANNCNANNNAACCNAGCACNGNGAGNAGCACACNNCNAAGCACAAGGCCAAACAGGAAAGGGCACAAGGNNCCAACCNCNNGNANCNNANAN
NNNCNNNCAACCAAGGCANANCANANNCANANNCANGACNAACCAANGCNCCNNAGCCAGAANGCAAAGNGAAACNNCCNAACAGNCAGAAAGNNANGCN
NNCNACNAGNGAGAAGAACAGCNGAAGCACCNGGAGGAAACGNNCCAAACGNCCACNAGAAGGCNCAGGGCCCNGACCANCANAACCANGNGGCAAAAGC
ACAACCAAACCAGNCGGGCGCAACCAANNCGCCNCNCCACCGCACACGAACCGGGCAAAAAANACCCGAGC
>LE_HBa0102L21_SP6_86968 (trimmed for quality and cloning vector)
TTGACGCCGCAAACATGGAAATAATTTGCTGGAGTTGTTACATTCACCACCTCCCATATAGGTTCCTGAATCTGCTTCCTTAGCGTAGGTTC

This is probably not a useful sequence.

Problems:
  • Short cloning insert
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.971194
Expected error %
2.45243
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0102L21
Clone
Clone name
hba-102l21
LE_HBa0102L21
P102L21
Clone type
BAC
Contamination
none
Estimated length
118,865
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found