Clone Read LE_HBa0102N10_SP6_87042

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0102N10_SP6_87042
Primer
SP6
ID from Seq. Facility
LE_HBa_102_N10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
497 trimmed for vector and quality, 757 raw
Genbank Accession
Sequence
>LE_HBa0102N10_SP6_87042 (raw untrimmed)
GTTTTGGCTCTTCATAATATTTGAGTGAGAAGAAAAAAAGGGCTTACCTTGATCGAGTCCTTGACTGAACCTCGTCCTCTGATGTAGACTCTGCACTCTG
TAATGGCTTCAACCCTCTTTAGGGAATTCCCACGTGGTCCCAAAATTCGACCGACAAAATTATACTGCATGTTTTTTATTTGGTCAAGATCTGTTCCAAA
ATTTAGAAAGAAAAAGAGCAACATGAAACACCACCCTAATAACGTTCACATACATTTGGGAAATTCTCCACAGGAACATCCAGTCTTATGACTCTCTTCA
CAACAGGAGTGGTTGCAGTTCCCGGCACAACATGCCAATCCAGAGGTGAAGGTTGAAATGGTGCTATTTTCTGGAGAAGTCTATTTTCCTGTAGTAAGTA
AAAAAACATCAAGTGGTAAATCATCCAGTATCAATGTCTGCAAGCAGTTATTCAAACTCCTTCAAGGTATTAATTATTTAAGATGGACTCAGCGAATATA
TTATCAAAACCTACATACAATATCTGTAATGCGGAATAAGACTAACAACTCCTATAATACCTGACTAAGGCTAACACCACAAAAAGTGCTAAGCTTTTTT
TTTCTTTCCATTTATGGGCTTACTAAGTTATGTTTTGTGCTTTGACAAAGGAAGCATCAATTTGTAAGGGAAAAATATCGTGGGTTATGTTTTTTATTAA
ATTATATCTTGTGAGCAAGGTATATGATTACGTTGTTATCGAAGGACAATAAATCGT
>LE_HBa0102N10_SP6_87042 (trimmed for quality and cloning vector)
GTGAGAAGAAAAAAAGGGCTTACCTTGATCGAGTCCTTGACTGAACCTCGTCCTCTGATGTAGACTCTGCACTCTGTAATGGCTTCAACCCTCTTTAGGG
AATTCCCACGTGGTCCCAAAATTCGACCGACAAAATTATACTGCATGTTTTTTATTTGGTCAAGATCTGTTCCAAAATTTAGAAAGAAAAAGAGCAACAT
GAAACACCACCCTAATAACGTTCACATACATTTGGGAAATTCTCCACAGGAACATCCAGTCTTATGACTCTCTTCACAACAGGAGTGGTTGCAGTTCCCG
GCACAACATGCCAATCCAGAGGTGAAGGTTGAAATGGTGCTATTTTCTGGAGAAGTCTATTTTCCTGTAGTAAGTAAAAAAACATCAAGTGGTAAATCAT
CCAGTATCAATGTCTGCAAGCAGTTATTCAAACTCCTTCAAGGTATTAATTATTTAAGATGGACTCAGCGAATATATTATCAAAACCTACATACAAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.968282
Expected error %
0.529432
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g09660.1 Score 74 E Value 1e-23 Identity 72.90% Align. Length 343bp (69.01%) Frame 1
68414.m01084 KH domain-containing quaking protein, putative similar to GB:AAC67357
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g09660.2 Score 74 E Value 1e-23 Identity 72.90% Align. Length 343bp (69.01%) Frame 1
68414.m01085 KH domain-containing quaking protein, putative similar to GB:AAC67357
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV25646.1| Score 78 E Value 1e-21 Identity 77.10% Align. Length 307bp (61.77%) Frame 1
unknown protein [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD82121.1| Score 78 E Value 1e-20 Identity 77.10% Align. Length 307bp (61.77%) Frame 1
QUAKING isoform 5-like [Oryza sativa (japonica cultivar-group)] dbj|BAD82237.1| QUAKING isoform 5-like [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0102N10
Clone
Clone name
hba-102n10
LE_HBa0102N10
C01HBa0102N10
P102N10
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found