Clone Read LE_HBa0120B12_SP6_87238

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0120B12_SP6_87238
Primer
SP6
ID from Seq. Facility
LE_HBa_120_B12-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
727 trimmed for vector and quality, 824 raw
Sequence
>LE_HBa0120B12_SP6_87238 (raw untrimmed)
GTTTGACGTGAGCTAGACTTCCCATGCTTCCCGCCTTCCTACTTAAAGCATCCGCTACAACATTCGCCTTCCCCGTATGATACAAGATAGTGATATCATA
GTCCTTTAGTAACTCCATCCATCTCCTCTGTCTTAAGTTCAAATCTTTTTGAGTAAAGACATACTGAAGGCTACGATGATCCGTGTAGACCTCACACTTA
ACCCCATATAAATAGTGTCTCCATTGCTTTAATGCAAACACTACCGCAGCCAATTCGAAATCATGAGTTGGATAGTTACGTTCATGCACCTTTAATTGCC
TTGAAGCATAAGCAATCACATTCTTCTCTTGCATTAGCACTGCACCCAAACCCGAATAGGATGCATCACAATAAACAATGAAGTTCTTACCCTCTACTGG
CAAGGTAAGGATAGGTGCGGTAGTCAACAAAGTCTTGAGCTTCTGAAAGCTTTCCTCACATTCGTCCGACCATACAAATGGAACATTCTGCTTAGTCAAG
TTCATCAATTGGGAAGCAATAGAAGAGAATTCCTTGACAAATCGACGGTAGTAGCTTGCTAACCCAACAAAGCTCCTTATTTCCGATACATTAGTAGGTC
TTACCCAATTCTTCACTGTCTCAATCTTAGAAGGATCCACCATCACTCCTTCCTTAGAAACCACGTGTCCCAAGAAGGACACTGCATCTAGCCAAAACTC
ACACTTAGAGAACTTGGCATAAAGCTTTTTCTCCCTCAACATTTCCAATACCATTCTCAAATGTTCTTCATGTTCCTTTCTTGCTCTTTGAGTATACCAA
TATATCATCAATAAATACGATCAC
>LE_HBa0120B12_SP6_87238 (trimmed for quality and cloning vector)
GAGCTAGACTTCCCATGCTTCCCGCCTTCCTACTTAAAGCATCCGCTACAACATTCGCCTTCCCCGTATGATACAAGATAGTGATATCATAGTCCTTTAG
TAACTCCATCCATCTCCTCTGTCTTAAGTTCAAATCTTTTTGAGTAAAGACATACTGAAGGCTACGATGATCCGTGTAGACCTCACACTTAACCCCATAT
AAATAGTGTCTCCATTGCTTTAATGCAAACACTACCGCAGCCAATTCGAAATCATGAGTTGGATAGTTACGTTCATGCACCTTTAATTGCCTTGAAGCAT
AAGCAATCACATTCTTCTCTTGCATTAGCACTGCACCCAAACCCGAATAGGATGCATCACAATAAACAATGAAGTTCTTACCCTCTACTGGCAAGGTAAG
GATAGGTGCGGTAGTCAACAAAGTCTTGAGCTTCTGAAAGCTTTCCTCACATTCGTCCGACCATACAAATGGAACATTCTGCTTAGTCAAGTTCATCAAT
TGGGAAGCAATAGAAGAGAATTCCTTGACAAATCGACGGTAGTAGCTTGCTAACCCAACAAAGCTCCTTATTTCCGATACATTAGTAGGTCTTACCCAAT
TCTTCACTGTCTCAATCTTAGAAGGATCCACCATCACTCCTTCCTTAGAAACCACGTGTCCCAAGAAGGACACTGCATCTAGCCAAAACTCACACTTAGA
GAACTTGGCATAAAGCTTTTTCTCCCT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.97226
Expected error %
0.0928513
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 367 E Value 1e-100 Identity 24.00% Align. Length 725bp (99.72%) Frame 3
putative polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 363 E Value 3e-99 Identity 24.00% Align. Length 725bp (99.72%) Frame 3
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0120B12
Clone
Clone name
hba-120b12
LE_HBa0120B12
P120B12
Clone type
BAC
Contamination
none
Estimated length
108,709
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found