Clone Read LE_HBa0120B12_T7_87239

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0120B12_T7_87239
Primer
T7
ID from Seq. Facility
LE_HBa_120_B12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
735 trimmed for vector and quality, 835 raw
Sequence
>LE_HBa0120B12_T7_87239 (raw untrimmed)
CCTGGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAACTGGGTGTTATTACATGACATATATATGAACATTTTTCTTCATTGAAAA
TATCGAAATATTAAGAAATAATAAATCAGTAAAACAAAAGAGCAATGTTTATATAGTAATAAATATTTTGAAGCAAACTTCCTGACAATCCAAATCACAT
GAGTAACATTGATAAATAAAGTCATTCTATTGTCTTGGACATAAAAAAAGTCTTGAGAAGTTAAATAATTTTGGCAAAAGATATTACAAGTGCATATCTA
CATTACAGGAGAAATTGTCAATAAAAACAAATGAATTTAGACTACAATATAAATTAAACTAATAAACATTTAAACTAGTGTTATAACAAGTCATAAAAAA
TATTTCTTCATAAAAAATAATTAAATATTAAGAAATAGTATATCAATAAAACAAAAGGACAATATTTATATAGTAATAACTATTTTGAAGCAAACTTTAT
GTCAATCTAAATAAGATAAGTAGCATTGACAACTAGAGTTATTATTTTGTATAGAGAATCAAAAAAATTAATCGGACAACTTATAACTTTTGAAAGATTT
AATAATTATTTACAAAATATATTCTAAAGCACATATCAACATCACAAGATAATTAGTTAACAAAAAAGAATGATTTAGACTACATCATGTTAATTTTCAT
ATATCGAATCATTACACACTAATGTATATATAAACGCAAAAAAAATAATTATTATATCAAAAAAAATTATTTTTCTCAAGTACTCCAAAGTAAAAGAATA
TACCTCTCTTATTTTATAAAAAATTACCTCCCTCA
>LE_HBa0120B12_T7_87239 (trimmed for quality and cloning vector)
AGCTTAACTGGGTGTTATTACATGACATATATATGAACATTTTTCTTCATTGAAAATATCGAAATATTAAGAAATAATAAATCAGTAAAACAAAAGAGCA
ATGTTTATATAGTAATAAATATTTTGAAGCAAACTTCCTGACAATCCAAATCACATGAGTAACATTGATAAATAAAGTCATTCTATTGTCTTGGACATAA
AAAAAGTCTTGAGAAGTTAAATAATTTTGGCAAAAGATATTACAAGTGCATATCTACATTACAGGAGAAATTGTCAATAAAAACAAATGAATTTAGACTA
CAATATAAATTAAACTAATAAACATTTAAACTAGTGTTATAACAAGTCATAAAAAATATTTCTTCATAAAAAATAATTAAATATTAAGAAATAGTATATC
AATAAAACAAAAGGACAATATTTATATAGTAATAACTATTTTGAAGCAAACTTTATGTCAATCTAAATAAGATAAGTAGCATTGACAACTAGAGTTATTA
TTTTGTATAGAGAATCAAAAAAATTAATCGGACAACTTATAACTTTTGAAAGATTTAATAATTATTTACAAAATATATTCTAAAGCACATATCAACATCA
CAAGATAATTAGTTAACAAAAAAGAATGATTTAGACTACATCATGTTAATTTTCATATATCGAATCATTACACACTAATGTATATATAAACGCAAAAAAA
ATAATTATTATATCAAAAAAAATTATTTTTCTCAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.854137
Expected error %
0.451264
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0120B12
Clone
Clone name
hba-120b12
LE_HBa0120B12
P120B12
Clone type
BAC
Contamination
none
Estimated length
108,709
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found