Clone Read LE_HBa0120B14_T7_87243

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0120B14_T7_87243
Primer
T7
ID from Seq. Facility
LE_HBa_120_B14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
642 trimmed for vector and quality, 823 raw
Sequence
>LE_HBa0120B14_T7_87243 (raw untrimmed)
CCTCGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTGCGGGACTCTTGACAGATAGAAATGCCTTGATAGTGCACTGTAAAGTGA
TTAAATCTGGTTTTGTGGATGCTCTAGTACTTGGAAATGCATTAATTCATGCATATGCAAGGTGTGGCTCAATATCTCGGGCCAGTCAGGTTTTTGAGGA
GATGAGGTACAGAGATATAGTGACATGGAATTCCATGTTGAAGGCTTATGCATTGCATGGCAAAGCAAATGAAGCATTGGGACTTTACAGTAAAATGGAT
GTGAAACCTGATGCAGCCACTTTTGTTGCTCTGCTTTCAGCTTGCAGCCATGCTGGAATGGTGCAAGAAGGGATTCAAATTTTTGATGCTATGTTTGCAA
AACACGGTATTGTTCCTCAACTCGAGCATTATGCATGTATAGTTGATATTGTTGGCCGAGCAGGTCATATTTTTCAGGCGGAGAAAATAATAAAAGAAAT
GCCCATGCAACCAGATTATGTGGTGTGGAGTGCATTTCTTGGAGCATGCCGCAAACATCGTGAATCTGGGCTTGCCCAAATAGCTGCATCTCAGTTGAAA
GAGTTAGATCCAGAAAATTCATTAGGATATGTACTCATGTCTAATGTATACTGCTCAAACCATAGCTTCTATGAAGCAGGTCATATTAGGAAGCAAATGA
GAGTGTTTGGTGTTACAAAGCATTCTTTGGTTTGAATTTGGTTATTTTTTTGTTAATGGGATTTTTGATCTTTAAATAGCACTAATTAATTTTACTCTTT
ATAATATTATACTCCTCATGTCC
>LE_HBa0120B14_T7_87243 (trimmed for quality and cloning vector)
AGCTTGTGCGGGACTCTTGACAGATAGAAATGCCTTGATAGTGCACTGTAAAGTGATTAAATCTGGTTTTGTGGATGCTCTAGTACTTGGAAATGCATTA
ATTCATGCATATGCAAGGTGTGGCTCAATATCTCGGGCCAGTCAGGTTTTTGAGGAGATGAGGTACAGAGATATAGTGACATGGAATTCCATGTTGAAGG
CTTATGCATTGCATGGCAAAGCAAATGAAGCATTGGGACTTTACAGTAAAATGGATGTGAAACCTGATGCAGCCACTTTTGTTGCTCTGCTTTCAGCTTG
CAGCCATGCTGGAATGGTGCAAGAAGGGATTCAAATTTTTGATGCTATGTTTGCAAAACACGGTATTGTTCCTCAACTCGAGCATTATGCATGTATAGTT
GATATTGTTGGCCGAGCAGGTCATATTTTTCAGGCGGAGAAAATAATAAAAGAAATGCCCATGCAACCAGATTATGTGGTGTGGAGTGCATTTCTTGGAG
CATGCCGCAAACATCGTGAATCTGGGCTTGCCCAAATAGCTGCATCTCAGTTGAAAGAGTTAGATCCAGAAAATTCATTAGGATATGTACTCATGTCTAA
TGTATACTGCTCAAACCATAGCTTCTATGAAGCAGGTCATAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.969495
Expected error %
0.498714
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g71420.1 Score 255 E Value 2e-68 Identity 18.80% Align. Length 632bp (98.44%) Frame 3
68414.m08249 pentatricopeptide (PPR) repeat-containing protein contains Pfam profile PF01535: PPR repeat
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g17630.1 Score 185 E Value 2e-47 Identity 42.50% Align. Length 635bp (98.91%) Frame 3
68414.m02181 pentatricopeptide (PPR) repeat-containing protein contains Pfam profile PF01535: PPR repeat
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_177298.1| Score 255 E Value 7e-67 Identity 18.80% Align. Length 632bp (98.44%) Frame 3
pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] gb|AAG51830.1| hypothetical protein; 56014-58251 [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAD40814.1| Score 192 E Value 7e-48 Identity 44.50% Align. Length 632bp (98.44%) Frame 3
OSJNBa0006B20.5 [Oryza sativa (japonica cultivar-group)] ref|XP_472582.1| OSJNBa0006B20.5 [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0120B14
Clone
Clone name
hba-120b14
LE_HBa0120B14
P120B14
Clone type
BAC
Contamination
none
Estimated length
117,901
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found