Clone Read LE_HBa0120C03_T7_87269

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0120C03_T7_87269
Primer
T7
ID from Seq. Facility
LE_HBa_120_C03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
659 trimmed for vector and quality, 813 raw
Sequence
>LE_HBa0120C03_T7_87269 (raw untrimmed)
GCTCGGTCCCGGGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAGCTTAGATGGTGCATTGCCACGTGAATGAAAGAAGTAAAGGTTATCAGTT
TATTTTAACTGCCGTGTATGGCCTTAGTACACCTGAACAGAGAAAGAGTTTGTGGAAAGAAATGGAAACACTGGCAAAAGGTATTTCTCAACCTTGGCTG
TTAGTAGGGGAGTTTAATGCTATATTGTATGCTAAGGATAGACTAGCTGGTCTGCCTGTTGCTATTAATGAGATAAAAGACTTTGGTGAGTGTGTGAGAG
ACATGGGGGTCAATGCATTGCAGTGGGCTGGTAATTACTACACCTGAAATAACAAACAATGTGGGAAGAATAGAATCTCCAGCAGAATAGATAGAGCCTT
TGGAAATGATGAATGGATGGATAAATGGGGGCATGTAACTGTAGAGTATGGGAATCCTAGTATATCAGATAATAGCTCTATGATGTTAACTCTTCAAAAA
ACTCAGCAGCATGGGAAATGAAGCTTCAAATTTTTCAATGTTTGGACTGAGCATGAGAGCTTTATGGAAATAGTAGAAATTACCTGGAAAAAAAGATTAT
GGTTATGATACAATGAAGCAGGTGTGGTGTAAACTGAAGGATCTCCAACATAGGTTACAACTTCTGAACAGGAAAGAGTTCAAGTATATTGGGAAGCAGA
TTTGATTTGGGCTAAAATCAATGTTTCATATTTTTTATCCCCTCTAAATGAACTTAGTTACTGATTAATTTGTTTGTGTAAGGAATAATAGTATTTTATT
CTTACCTAATTAN
>LE_HBa0120C03_T7_87269 (trimmed for quality and cloning vector)
AGCTTAGCTTAGATGGTGCATTGCCACGTGAATGAAAGAAGTAAAGGTTATCAGTTTATTTTAACTGCCGTGTATGGCCTTAGTACACCTGAACAGAGAA
AGAGTTTGTGGAAAGAAATGGAAACACTGGCAAAAGGTATTTCTCAACCTTGGCTGTTAGTAGGGGAGTTTAATGCTATATTGTATGCTAAGGATAGACT
AGCTGGTCTGCCTGTTGCTATTAATGAGATAAAAGACTTTGGTGAGTGTGTGAGAGACATGGGGGTCAATGCATTGCAGTGGGCTGGTAATTACTACACC
TGAAATAACAAACAATGTGGGAAGAATAGAATCTCCAGCAGAATAGATAGAGCCTTTGGAAATGATGAATGGATGGATAAATGGGGGCATGTAACTGTAG
AGTATGGGAATCCTAGTATATCAGATAATAGCTCTATGATGTTAACTCTTCAAAAAACTCAGCAGCATGGGAAATGAAGCTTCAAATTTTTCAATGTTTG
GACTGAGCATGAGAGCTTTATGGAAATAGTAGAAATTACCTGGAAAAAAAGATTATGGTTATGATACAATGAAGCAGGTGTGGTGTAAACTGAAGGATCT
CCAACATAGGTTACAACTTCTGAACAGGAAAGAGTTCAAGTATATTGGGAAGCAGATTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.947528
Expected error %
0.839719
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g40390.1 Score 77 E Value 8e-15 Identity 9.90% Align. Length 476bp (72.23%) Frame 2
68414.m04790 hypothetical protein
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g43760.1 Score 65 E Value 2e-11 Identity 8.50% Align. Length 422bp (64.04%) Frame 2
68414.m05034 hypothetical protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB79491.1| Score 87 E Value 4e-16 Identity 9.60% Align. Length 530bp (80.42%) Frame 2
putative protein [Arabidopsis thaliana] emb|CAA18234.1| putative protein [Arabidopsis thaliana] pir||T05068 hypothetical protein M3E9.210 - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAB01845.1| Score 84 E Value 3e-15 Identity 9.80% Align. Length 530bp (80.42%) Frame 2
non-LTR retroelement reverse transcriptase-like protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0120C03
Clone
Clone name
hba-120c3
LE_HBa0120C03
P120C03
Clone type
BAC
Contamination
none
Estimated length
79,683
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found